\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416201160:

Variant ID: vg0416201160 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 16201160
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTCGAGCCCAGGTGCAATACACAGTCTGTTACTAAACGAATGAAATGTAAGTAAGCCCGAGTTTAGTTCCAAACTTTTTCTTCAAACTTAGAACTTTTT[C/T]
ATCGCATCAAAATTTTTCTACATATACAAACTTTCAATTTTTCCTATCACATTGTTTCAATTTGGAAAAAGTATACTTTGACTCCCTTAACTATGACCCG

Reverse complement sequence

CGGGTCATAGTTAAGGGAGTCAAAGTATACTTTTTCCAAATTGAAACAATGTGATAGGAAAAATTGAAAGTTTGTATATGTAGAAAAATTTTGATGCGAT[G/A]
AAAAAGTTCTAAGTTTGAAGAAAAAGTTTGGAACTAAACTCGGGCTTACTTACATTTCATTCGTTTAGTAACAGACTGTGTATTGCACCTGGGCTCGACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 11.80% 0.32% 19.17% NA
All Indica  2759 79.10% 7.80% 0.29% 12.79% NA
All Japonica  1512 65.10% 0.40% 0.20% 34.33% NA
Aus  269 1.10% 95.20% 0.37% 3.35% NA
Indica I  595 99.30% 0.30% 0.00% 0.34% NA
Indica II  465 78.50% 14.80% 0.22% 6.45% NA
Indica III  913 64.20% 7.90% 0.22% 27.71% NA
Indica Intermediate  786 81.60% 9.20% 0.64% 8.65% NA
Temperate Japonica  767 70.80% 0.00% 0.00% 29.20% NA
Tropical Japonica  504 49.40% 0.40% 0.40% 49.80% NA
Japonica Intermediate  241 79.70% 1.70% 0.41% 18.26% NA
VI/Aromatic  96 14.60% 71.90% 0.00% 13.54% NA
Intermediate  90 67.80% 15.60% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416201160 C -> DEL N N silent_mutation Average:87.684; most accessible tissue: Minghui63 root, score: 93.841 N N N N
vg0416201160 C -> T LOC_Os04g27410.1 intron_variant ; MODIFIER silent_mutation Average:87.684; most accessible tissue: Minghui63 root, score: 93.841 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0416201160 C T 0.01 0.01 0.02 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416201160 NA 2.05E-12 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160 NA 2.17E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160 NA 2.38E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160 NA 3.97E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160 NA 4.20E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160 NA 1.56E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160 NA 6.55E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160 NA 9.69E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416201160 NA 2.67E-06 mr1815_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251