\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416168444:

Variant ID: vg0416168444 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 16168444
Reference Allele: TAlternative Allele: C,TCC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTTTCTCAAGTTATGGATCAAAATGGTCAGATAGTTTATTTGCATGATCAAAAAGCAAGTCTTTTCTATCAAAGTTTCGAAAACAGTATGGGTATCTC[T/C,TCC]
TGCTCCCCAAGAATGGTCTTTGATTTGAATGATCTCTTTCTTCCTAGGGCAGACTTGGAATACTTGACTGATATGTTTTCCACTCAAGAGATTGATAGTC

Reverse complement sequence

GACTATCAATCTCTTGAGTGGAAAACATATCAGTCAAGTATTCCAAGTCTGCCCTAGGAAGAAAGAGATCATTCAAATCAAAGACCATTCTTGGGGAGCA[A/G,GGA]
GAGATACCCATACTGTTTTCGAAACTTTGATAGAAAAGACTTGCTTTTTGATCATGCAAATAAACTATCTGACCATTTTGATCCATAACTTGAGAAACTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 14.00% 0.13% 0.23% TCC: 9.80%
All Indica  2759 74.50% 13.50% 0.14% 0.40% TCC: 11.45%
All Japonica  1512 90.30% 0.50% 0.00% 0.00% TCC: 9.13%
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 89.10% 10.60% 0.17% 0.00% TCC: 0.17%
Indica II  465 77.40% 16.10% 0.22% 1.94% TCC: 4.30%
Indica III  913 59.70% 15.30% 0.00% 0.22% TCC: 24.75%
Indica Intermediate  786 79.00% 12.00% 0.25% 0.00% TCC: 8.78%
Temperate Japonica  767 99.20% 0.00% 0.00% 0.00% TCC: 0.78%
Tropical Japonica  504 73.60% 1.40% 0.00% 0.00% TCC: 25.00%
Japonica Intermediate  241 97.10% 0.40% 0.00% 0.00% TCC: 2.49%
VI/Aromatic  96 81.20% 13.50% 2.08% 0.00% TCC: 3.12%
Intermediate  90 85.60% 7.80% 0.00% 0.00% TCC: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416168444 T -> C LOC_Os04g27360.1 upstream_gene_variant ; 13.0bp to feature; MODIFIER silent_mutation Average:32.474; most accessible tissue: Callus, score: 60.942 N N N N
vg0416168444 T -> C LOC_Os04g27370.1 upstream_gene_variant ; 4953.0bp to feature; MODIFIER silent_mutation Average:32.474; most accessible tissue: Callus, score: 60.942 N N N N
vg0416168444 T -> C LOC_Os04g27350.1 downstream_gene_variant ; 454.0bp to feature; MODIFIER silent_mutation Average:32.474; most accessible tissue: Callus, score: 60.942 N N N N
vg0416168444 T -> C LOC_Os04g27350-LOC_Os04g27360 intergenic_region ; MODIFIER silent_mutation Average:32.474; most accessible tissue: Callus, score: 60.942 N N N N
vg0416168444 T -> DEL N N silent_mutation Average:32.474; most accessible tissue: Callus, score: 60.942 N N N N
vg0416168444 T -> TCC LOC_Os04g27360.1 upstream_gene_variant ; 12.0bp to feature; MODIFIER silent_mutation Average:32.474; most accessible tissue: Callus, score: 60.942 N N N N
vg0416168444 T -> TCC LOC_Os04g27370.1 upstream_gene_variant ; 4952.0bp to feature; MODIFIER silent_mutation Average:32.474; most accessible tissue: Callus, score: 60.942 N N N N
vg0416168444 T -> TCC LOC_Os04g27350.1 downstream_gene_variant ; 455.0bp to feature; MODIFIER silent_mutation Average:32.474; most accessible tissue: Callus, score: 60.942 N N N N
vg0416168444 T -> TCC LOC_Os04g27350-LOC_Os04g27360 intergenic_region ; MODIFIER silent_mutation Average:32.474; most accessible tissue: Callus, score: 60.942 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416168444 NA 6.87E-06 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416168444 1.81E-07 2.46E-06 mr1925 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251