\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415427207:

Variant ID: vg0415427207 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 15427207
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCATTAACTTCCGTCTTTTTCCACTGAAGGAAAAATGTTTCACATAAAGGAAATTCAATTGTCTGTTGTTATAAAGGAAATAAGAATCTTTTTATTTGT[C/A]
AGTTGTTTATTTGTAGGTCATTGTGCGTATGTTTCAAAATACTGAATTATACTTGCTATTTTTTTTTTGATTTTGCAAGTTATTGAATACTTCTACATAT

Reverse complement sequence

ATATGTAGAAGTATTCAATAACTTGCAAAATCAAAAAAAAAATAGCAAGTATAATTCAGTATTTTGAAACATACGCACAATGACCTACAAATAAACAACT[G/T]
ACAAATAAAAAGATTCTTATTTCCTTTATAACAACAGACAATTGAATTTCCTTTATGTGAAACATTTTTCCTTCAGTGGAAAAAGACGGAAGTTAATGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 6.60% 0.63% 12.78% NA
All Indica  2759 85.60% 0.30% 0.43% 13.63% NA
All Japonica  1512 79.60% 19.60% 0.73% 0.07% NA
Aus  269 17.80% 0.00% 1.49% 80.67% NA
Indica I  595 92.60% 0.20% 0.84% 6.39% NA
Indica II  465 78.50% 1.30% 0.43% 19.78% NA
Indica III  913 84.10% 0.00% 0.44% 15.44% NA
Indica Intermediate  786 86.30% 0.30% 0.13% 13.36% NA
Temperate Japonica  767 62.20% 36.40% 1.43% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.00% 0.20% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 0.00% 3.12% 5.21% NA
Intermediate  90 86.70% 7.80% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0415427207 C -> DEL N N silent_mutation Average:21.915; most accessible tissue: Callus, score: 44.732 N N N N
vg0415427207 C -> A LOC_Os04g26450.1 upstream_gene_variant ; 1435.0bp to feature; MODIFIER silent_mutation Average:21.915; most accessible tissue: Callus, score: 44.732 N N N N
vg0415427207 C -> A LOC_Os04g26440.1 downstream_gene_variant ; 955.0bp to feature; MODIFIER silent_mutation Average:21.915; most accessible tissue: Callus, score: 44.732 N N N N
vg0415427207 C -> A LOC_Os04g26440-LOC_Os04g26450 intergenic_region ; MODIFIER silent_mutation Average:21.915; most accessible tissue: Callus, score: 44.732 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0415427207 1.47E-06 1.47E-06 mr1430 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415427207 7.69E-06 1.45E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251