Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0415427207:

Variant ID: vg0415427207 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 15427207
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCATTAACTTCCGTCTTTTTCCACTGAAGGAAAAATGTTTCACATAAAGGAAATTCAATTGTCTGTTGTTATAAAGGAAATAAGAATCTTTTTATTTGT[C/A]
AGTTGTTTATTTGTAGGTCATTGTGCGTATGTTTCAAAATACTGAATTATACTTGCTATTTTTTTTTTGATTTTGCAAGTTATTGAATACTTCTACATAT

Reverse complement sequence

ATATGTAGAAGTATTCAATAACTTGCAAAATCAAAAAAAAAATAGCAAGTATAATTCAGTATTTTGAAACATACGCACAATGACCTACAAATAAACAACT[G/T]
ACAAATAAAAAGATTCTTATTTCCTTTATAACAACAGACAATTGAATTTCCTTTATGTGAAACATTTTTCCTTCAGTGGAAAAAGACGGAAGTTAATGAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.00%	6.60%	0.63%	12.78%	NA
All Indica	2759	85.60%	0.30%	0.43%	13.63%	NA
All Japonica	1512	79.60%	19.60%	0.73%	0.07%	NA
Aus	269	17.80%	0.00%	1.49%	80.67%	NA
Indica I	595	92.60%	0.20%	0.84%	6.39%	NA
Indica II	465	78.50%	1.30%	0.43%	19.78%	NA
Indica III	913	84.10%	0.00%	0.44%	15.44%	NA
Indica Intermediate	786	86.30%	0.30%	0.13%	13.36%	NA
Temperate Japonica	767	62.20%	36.40%	1.43%	0.00%	NA
Tropical Japonica	504	99.00%	0.80%	0.00%	0.20%	NA
Japonica Intermediate	241	94.60%	5.40%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	0.00%	3.12%	5.21%	NA
Intermediate	90	86.70%	7.80%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0415427207	C -> DEL	N	N	silent_mutation	Average:21.915; most accessible tissue: Callus, score: 44.732	N	N	N	N
vg0415427207	C -> A	LOC_Os04g26450.1	upstream_gene_variant ; 1435.0bp to feature; MODIFIER	silent_mutation	Average:21.915; most accessible tissue: Callus, score: 44.732	N	N	N	N
vg0415427207	C -> A	LOC_Os04g26440.1	downstream_gene_variant ; 955.0bp to feature; MODIFIER	silent_mutation	Average:21.915; most accessible tissue: Callus, score: 44.732	N	N	N	N
vg0415427207	C -> A	LOC_Os04g26440-LOC_Os04g26450	intergenic_region ; MODIFIER	silent_mutation	Average:21.915; most accessible tissue: Callus, score: 44.732	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0415427207	1.47E-06	1.47E-06	mr1430	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415427207	7.69E-06	1.45E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251