Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0415345317:

Variant ID: vg0415345317 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 15345317
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAATATGAAGGGATACAAAGGACGGGCAGGGTTATCACCACCTGTCGTCTACCCTACTTTCCGTGTAGCACACAACAAACGAAGGTAACCTCTAACCTA[G/A]
ACACCACACCTACGTTATCGATTACTACTCTAGCCTCGGCCAAGAACTATCTTGTTTATCCAGAGTCTTAGTACTAGAGCATTAAGTATAAATACTAAGC

Reverse complement sequence

GCTTAGTATTTATACTTAATGCTCTAGTACTAAGACTCTGGATAAACAAGATAGTTCTTGGCCGAGGCTAGAGTAGTAATCGATAACGTAGGTGTGGTGT[C/T]
TAGGTTAGAGGTTACCTTCGTTTGTTGTGTGCTACACGGAAAGTAGGGTAGACGACAGGTGGTGATAACCCTGCCCGTCCTTTGTATCCCTTCATATTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.30% 1.90% 13.92% 10.92% NA
All Indica  2759 75.00% 3.10% 16.75% 5.18% NA
All Japonica  1512 79.30% 0.10% 0.79% 19.84% NA
Aus  269 13.40% 0.00% 63.57% 23.05% NA
Indica I  595 91.40% 0.00% 8.24% 0.34% NA
Indica II  465 67.30% 14.80% 16.13% 1.72% NA
Indica III  913 64.60% 0.80% 24.75% 9.86% NA
Indica Intermediate  786 79.10% 1.10% 14.25% 5.47% NA
Temperate Japonica  767 61.70% 0.00% 1.04% 37.29% NA
Tropical Japonica  504 99.00% 0.00% 0.40% 0.60% NA
Japonica Intermediate  241 94.20% 0.40% 0.83% 4.56% NA
VI/Aromatic  96 91.70% 0.00% 5.21% 3.12% NA
Intermediate  90 80.00% 2.20% 8.89% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0415345317 G -> DEL N N silent_mutation Average:48.062; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0415345317 G -> A LOC_Os04g26310.1 downstream_gene_variant ; 3243.0bp to feature; MODIFIER silent_mutation Average:48.062; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0415345317 G -> A LOC_Os04g26320.1 intron_variant ; MODIFIER silent_mutation Average:48.062; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0415345317 3.97E-08 NA mr1071_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415345317 7.51E-07 NA mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415345317 1.39E-06 NA mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415345317 NA 1.16E-06 mr1362_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251