\
| Variant ID: vg0414782841 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14782841 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTTTATTGATTGAGAGGAACTATCTACCTATGTAATGACATTTTATTCGCTTATTAATTAGAGTAATAATTGTACTCTATTATCAGTTTGTTATTGTGTG[T/C]
CTCGGCTGATTCCTAGACGAGGGTTCACACACATGTAAGCTTTTGGAATTTTGGATAGAAATTCCGGGCGTAACAGTACATCCATTAATAGATGCAGAGA
TCTCTGCATCTATTAATGGATGTACTGTTACGCCCGGAATTTCTATCCAAAATTCCAAAAGCTTACATGTGTGTGAACCCTCGTCTAGGAATCAGCCGAG[A/G]
CACACAATAACAAACTGATAATAGAGTACAATTATTACTCTAATTAATAAGCGAATAAAATGTCATTACATAGGTAGATAGTTCCTCTCAATCAATAAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.90% | 19.40% | 4.25% | 1.46% | NA |
| All Indica | 2759 | 79.50% | 20.00% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 78.40% | 5.20% | 11.84% | 4.56% | NA |
| Aus | 269 | 2.20% | 97.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 88.90% | 10.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 64.70% | 33.30% | 1.94% | 0.00% | NA |
| Indica III | 913 | 78.20% | 21.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.70% | 16.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 60.20% | 8.90% | 22.03% | 8.87% | NA |
| Tropical Japonica | 504 | 99.00% | 0.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 2.90% | 3.32% | 0.41% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 10.00% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414782841 | T -> C | LOC_Os04g25490.1 | upstream_gene_variant ; 4510.0bp to feature; MODIFIER | silent_mutation | Average:70.942; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| vg0414782841 | T -> C | LOC_Os04g25480-LOC_Os04g25490 | intergenic_region ; MODIFIER | silent_mutation | Average:70.942; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| vg0414782841 | T -> DEL | N | N | silent_mutation | Average:70.942; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414782841 | NA | 7.67E-08 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414782841 | NA | 2.62E-06 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414782841 | NA | 4.02E-06 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414782841 | NA | 5.94E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414782841 | 3.98E-06 | NA | mr1877 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414782841 | NA | 8.68E-08 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414782841 | NA | 1.16E-08 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414782841 | NA | 1.62E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414782841 | NA | 4.07E-06 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |