\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414782841:

Variant ID: vg0414782841 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14782841
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTATTGATTGAGAGGAACTATCTACCTATGTAATGACATTTTATTCGCTTATTAATTAGAGTAATAATTGTACTCTATTATCAGTTTGTTATTGTGTG[T/C]
CTCGGCTGATTCCTAGACGAGGGTTCACACACATGTAAGCTTTTGGAATTTTGGATAGAAATTCCGGGCGTAACAGTACATCCATTAATAGATGCAGAGA

Reverse complement sequence

TCTCTGCATCTATTAATGGATGTACTGTTACGCCCGGAATTTCTATCCAAAATTCCAAAAGCTTACATGTGTGTGAACCCTCGTCTAGGAATCAGCCGAG[A/G]
CACACAATAACAAACTGATAATAGAGTACAATTATTACTCTAATTAATAAGCGAATAAAATGTCATTACATAGGTAGATAGTTCCTCTCAATCAATAAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 19.40% 4.25% 1.46% NA
All Indica  2759 79.50% 20.00% 0.47% 0.00% NA
All Japonica  1512 78.40% 5.20% 11.84% 4.56% NA
Aus  269 2.20% 97.40% 0.37% 0.00% NA
Indica I  595 88.90% 10.90% 0.17% 0.00% NA
Indica II  465 64.70% 33.30% 1.94% 0.00% NA
Indica III  913 78.20% 21.80% 0.00% 0.00% NA
Indica Intermediate  786 82.70% 16.90% 0.38% 0.00% NA
Temperate Japonica  767 60.20% 8.90% 22.03% 8.87% NA
Tropical Japonica  504 99.00% 0.60% 0.40% 0.00% NA
Japonica Intermediate  241 93.40% 2.90% 3.32% 0.41% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 81.10% 10.00% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414782841 T -> C LOC_Os04g25490.1 upstream_gene_variant ; 4510.0bp to feature; MODIFIER silent_mutation Average:70.942; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 N N N N
vg0414782841 T -> C LOC_Os04g25480-LOC_Os04g25490 intergenic_region ; MODIFIER silent_mutation Average:70.942; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 N N N N
vg0414782841 T -> DEL N N silent_mutation Average:70.942; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414782841 NA 7.67E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841 NA 2.62E-06 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841 NA 4.02E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841 NA 5.94E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841 3.98E-06 NA mr1877 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841 NA 8.68E-08 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841 NA 1.16E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841 NA 1.62E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841 NA 4.07E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251