Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0414782841:

Variant ID: vg0414782841 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14782841
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTTATTGATTGAGAGGAACTATCTACCTATGTAATGACATTTTATTCGCTTATTAATTAGAGTAATAATTGTACTCTATTATCAGTTTGTTATTGTGTG[T/C]
CTCGGCTGATTCCTAGACGAGGGTTCACACACATGTAAGCTTTTGGAATTTTGGATAGAAATTCCGGGCGTAACAGTACATCCATTAATAGATGCAGAGA

Reverse complement sequence

TCTCTGCATCTATTAATGGATGTACTGTTACGCCCGGAATTTCTATCCAAAATTCCAAAAGCTTACATGTGTGTGAACCCTCGTCTAGGAATCAGCCGAG[A/G]
CACACAATAACAAACTGATAATAGAGTACAATTATTACTCTAATTAATAAGCGAATAAAATGTCATTACATAGGTAGATAGTTCCTCTCAATCAATAAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	19.40%	4.25%	1.46%	NA
All Indica	2759	79.50%	20.00%	0.47%	0.00%	NA
All Japonica	1512	78.40%	5.20%	11.84%	4.56%	NA
Aus	269	2.20%	97.40%	0.37%	0.00%	NA
Indica I	595	88.90%	10.90%	0.17%	0.00%	NA
Indica II	465	64.70%	33.30%	1.94%	0.00%	NA
Indica III	913	78.20%	21.80%	0.00%	0.00%	NA
Indica Intermediate	786	82.70%	16.90%	0.38%	0.00%	NA
Temperate Japonica	767	60.20%	8.90%	22.03%	8.87%	NA
Tropical Japonica	504	99.00%	0.60%	0.40%	0.00%	NA
Japonica Intermediate	241	93.40%	2.90%	3.32%	0.41%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	81.10%	10.00%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414782841	T -> C	LOC_Os04g25490.1	upstream_gene_variant ; 4510.0bp to feature; MODIFIER	silent_mutation	Average:70.942; most accessible tissue: Zhenshan97 flag leaf, score: 86.342	N	N	N	N
vg0414782841	T -> C	LOC_Os04g25480-LOC_Os04g25490	intergenic_region ; MODIFIER	silent_mutation	Average:70.942; most accessible tissue: Zhenshan97 flag leaf, score: 86.342	N	N	N	N
vg0414782841	T -> DEL	N	N	silent_mutation	Average:70.942; most accessible tissue: Zhenshan97 flag leaf, score: 86.342	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414782841	NA	7.67E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841	NA	2.62E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841	NA	4.02E-06	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841	NA	5.94E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841	3.98E-06	NA	mr1877	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841	NA	8.68E-08	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841	NA	1.16E-08	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841	NA	1.62E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414782841	NA	4.07E-06	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251