\
| Variant ID: vg0414582739 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14582739 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATGATAAGGTCTAAAGTAAGTTAGTTAGGCGAACGGCCATGCCATTGTTAACAAACATCCCTCGGACCTGTGTATTAGTGATAAGGTCCAAAGTAAATG[G/A]
ATTAGGCGAACAACCATGCCATTATTAACAAAATACTCCTCAGACCTGTATATTCTAGATGGGGTCCAGAGTAAATACATGAGGCAAAAATCCATGCCAT
ATGGCATGGATTTTTGCCTCATGTATTTACTCTGGACCCCATCTAGAATATACAGGTCTGAGGAGTATTTTGTTAATAATGGCATGGTTGTTCGCCTAAT[C/T]
CATTTACTTTGGACCTTATCACTAATACACAGGTCCGAGGGATGTTTGTTAACAATGGCATGGCCGTTCGCCTAACTAACTTACTTTAGACCTTATCATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 1.40% | 6.77% | 5.21% | NA |
| All Indica | 2759 | 83.30% | 2.30% | 10.08% | 4.35% | NA |
| All Japonica | 1512 | 91.10% | 0.20% | 1.39% | 7.34% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 66.70% | 4.00% | 15.46% | 13.78% | NA |
| Indica II | 465 | 82.60% | 2.40% | 14.19% | 0.86% | NA |
| Indica III | 913 | 98.10% | 0.50% | 0.88% | 0.44% | NA |
| Indica Intermediate | 786 | 79.00% | 2.90% | 14.25% | 3.82% | NA |
| Temperate Japonica | 767 | 87.40% | 0.00% | 1.56% | 11.08% | NA |
| Tropical Japonica | 504 | 97.40% | 0.00% | 0.99% | 1.59% | NA |
| Japonica Intermediate | 241 | 89.60% | 1.20% | 1.66% | 7.47% | NA |
| VI/Aromatic | 96 | 79.20% | 0.00% | 10.42% | 10.42% | NA |
| Intermediate | 90 | 81.10% | 1.10% | 12.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414582739 | G -> DEL | N | N | silent_mutation | Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0414582739 | G -> A | LOC_Os04g25210.1 | upstream_gene_variant ; 4227.0bp to feature; MODIFIER | silent_mutation | Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0414582739 | G -> A | LOC_Os04g25220.1 | downstream_gene_variant ; 1700.0bp to feature; MODIFIER | silent_mutation | Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0414582739 | G -> A | LOC_Os04g25230.1 | downstream_gene_variant ; 3911.0bp to feature; MODIFIER | silent_mutation | Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0414582739 | G -> A | LOC_Os04g25220-LOC_Os04g25230 | intergenic_region ; MODIFIER | silent_mutation | Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414582739 | NA | 2.12E-09 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414582739 | NA | 2.25E-07 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414582739 | NA | 4.80E-07 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414582739 | NA | 3.67E-06 | mr1726_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414582739 | NA | 6.82E-06 | mr1892_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414582739 | NA | 2.01E-06 | mr1950_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |