\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414582739:

Variant ID: vg0414582739 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14582739
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGATAAGGTCTAAAGTAAGTTAGTTAGGCGAACGGCCATGCCATTGTTAACAAACATCCCTCGGACCTGTGTATTAGTGATAAGGTCCAAAGTAAATG[G/A]
ATTAGGCGAACAACCATGCCATTATTAACAAAATACTCCTCAGACCTGTATATTCTAGATGGGGTCCAGAGTAAATACATGAGGCAAAAATCCATGCCAT

Reverse complement sequence

ATGGCATGGATTTTTGCCTCATGTATTTACTCTGGACCCCATCTAGAATATACAGGTCTGAGGAGTATTTTGTTAATAATGGCATGGTTGTTCGCCTAAT[C/T]
CATTTACTTTGGACCTTATCACTAATACACAGGTCCGAGGGATGTTTGTTAACAATGGCATGGCCGTTCGCCTAACTAACTTACTTTAGACCTTATCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 1.40% 6.77% 5.21% NA
All Indica  2759 83.30% 2.30% 10.08% 4.35% NA
All Japonica  1512 91.10% 0.20% 1.39% 7.34% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 66.70% 4.00% 15.46% 13.78% NA
Indica II  465 82.60% 2.40% 14.19% 0.86% NA
Indica III  913 98.10% 0.50% 0.88% 0.44% NA
Indica Intermediate  786 79.00% 2.90% 14.25% 3.82% NA
Temperate Japonica  767 87.40% 0.00% 1.56% 11.08% NA
Tropical Japonica  504 97.40% 0.00% 0.99% 1.59% NA
Japonica Intermediate  241 89.60% 1.20% 1.66% 7.47% NA
VI/Aromatic  96 79.20% 0.00% 10.42% 10.42% NA
Intermediate  90 81.10% 1.10% 12.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414582739 G -> DEL N N silent_mutation Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0414582739 G -> A LOC_Os04g25210.1 upstream_gene_variant ; 4227.0bp to feature; MODIFIER silent_mutation Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0414582739 G -> A LOC_Os04g25220.1 downstream_gene_variant ; 1700.0bp to feature; MODIFIER silent_mutation Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0414582739 G -> A LOC_Os04g25230.1 downstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0414582739 G -> A LOC_Os04g25220-LOC_Os04g25230 intergenic_region ; MODIFIER silent_mutation Average:39.901; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414582739 NA 2.12E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414582739 NA 2.25E-07 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414582739 NA 4.80E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414582739 NA 3.67E-06 mr1726_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414582739 NA 6.82E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414582739 NA 2.01E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251