Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414510569:

Variant ID: vg0414510569 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14510569
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

TACGGGGTGAAAAGAAGAGGAAACAAGACAATCAAACACCGAATGAAATATCCGAATGTATGAACTCTCTACATCATCCTTAATTTTTTACTTATATTCT[A/C]
TGTTTATGTGTTACTGATTTGACTTACCCTTTTCTAGTGTACATCGAGAAGGAAGATCTTACCCAAAAAAACATAGACAAAGGCCCACCAAAGAACGCCT

Reverse complement sequence

AGGCGTTCTTTGGTGGGCCTTTGTCTATGTTTTTTTGGGTAAGATCTTCCTTCTCGATGTACACTAGAAAAGGGTAAGTCAAATCAGTAACACATAAACA[T/G]
AGAATATAAGTAAAAAATTAAGGATGATGTAGAGAGTTCATACATTCGGATATTTCATTCGGTGTTTGATTGTCTTGTTTCCTCTTCTTTTCACCCCGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	35.90%	6.31%	7.51%	NA
All Indica	2759	81.30%	8.40%	3.88%	6.42%	NA
All Japonica	1512	2.80%	83.40%	5.36%	8.47%	NA
Aus	269	17.50%	47.60%	23.42%	11.52%	NA
Indica I	595	83.90%	13.30%	2.52%	0.34%	NA
Indica II	465	87.30%	6.90%	3.87%	1.94%	NA
Indica III	913	76.30%	7.60%	4.60%	11.50%	NA
Indica Intermediate	786	81.40%	6.70%	4.07%	7.76%	NA
Temperate Japonica	767	1.80%	94.80%	1.83%	1.56%	NA
Tropical Japonica	504	3.20%	68.80%	9.52%	18.45%	NA
Japonica Intermediate	241	5.00%	77.60%	7.88%	9.54%	NA
VI/Aromatic	96	11.50%	40.60%	36.46%	11.46%	NA
Intermediate	90	36.70%	41.10%	13.33%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414510569	A -> C	LOC_Os04g25130.1	downstream_gene_variant ; 1520.0bp to feature; MODIFIER	silent_mutation	Average:17.036; most accessible tissue: Callus, score: 29.459	N	N	N	N
vg0414510569	A -> C	LOC_Os04g25120.1	intron_variant ; MODIFIER	silent_mutation	Average:17.036; most accessible tissue: Callus, score: 29.459	N	N	N	N
vg0414510569	A -> DEL	N	N	silent_mutation	Average:17.036; most accessible tissue: Callus, score: 29.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414510569	NA	6.83E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	2.93E-15	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	1.14E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	1.13E-22	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	8.86E-06	mr1344	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	2.47E-07	2.21E-12	mr1379	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	8.30E-06	NA	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	9.17E-32	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	2.27E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	7.90E-23	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	1.35E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	1.05E-17	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	1.26E-13	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	1.42E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	2.48E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	4.74E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	6.05E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	2.45E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	9.68E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	3.04E-11	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	9.79E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	2.96E-24	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569	NA	1.21E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251