\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414510569:

Variant ID: vg0414510569 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14510569
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TACGGGGTGAAAAGAAGAGGAAACAAGACAATCAAACACCGAATGAAATATCCGAATGTATGAACTCTCTACATCATCCTTAATTTTTTACTTATATTCT[A/C]
TGTTTATGTGTTACTGATTTGACTTACCCTTTTCTAGTGTACATCGAGAAGGAAGATCTTACCCAAAAAAACATAGACAAAGGCCCACCAAAGAACGCCT

Reverse complement sequence

AGGCGTTCTTTGGTGGGCCTTTGTCTATGTTTTTTTGGGTAAGATCTTCCTTCTCGATGTACACTAGAAAAGGGTAAGTCAAATCAGTAACACATAAACA[T/G]
AGAATATAAGTAAAAAATTAAGGATGATGTAGAGAGTTCATACATTCGGATATTTCATTCGGTGTTTGATTGTCTTGTTTCCTCTTCTTTTCACCCCGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 35.90% 6.31% 7.51% NA
All Indica  2759 81.30% 8.40% 3.88% 6.42% NA
All Japonica  1512 2.80% 83.40% 5.36% 8.47% NA
Aus  269 17.50% 47.60% 23.42% 11.52% NA
Indica I  595 83.90% 13.30% 2.52% 0.34% NA
Indica II  465 87.30% 6.90% 3.87% 1.94% NA
Indica III  913 76.30% 7.60% 4.60% 11.50% NA
Indica Intermediate  786 81.40% 6.70% 4.07% 7.76% NA
Temperate Japonica  767 1.80% 94.80% 1.83% 1.56% NA
Tropical Japonica  504 3.20% 68.80% 9.52% 18.45% NA
Japonica Intermediate  241 5.00% 77.60% 7.88% 9.54% NA
VI/Aromatic  96 11.50% 40.60% 36.46% 11.46% NA
Intermediate  90 36.70% 41.10% 13.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414510569 A -> C LOC_Os04g25130.1 downstream_gene_variant ; 1520.0bp to feature; MODIFIER silent_mutation Average:17.036; most accessible tissue: Callus, score: 29.459 N N N N
vg0414510569 A -> C LOC_Os04g25120.1 intron_variant ; MODIFIER silent_mutation Average:17.036; most accessible tissue: Callus, score: 29.459 N N N N
vg0414510569 A -> DEL N N silent_mutation Average:17.036; most accessible tissue: Callus, score: 29.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414510569 NA 6.83E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 2.93E-15 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 1.14E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 1.13E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 8.86E-06 mr1344 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 2.47E-07 2.21E-12 mr1379 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 8.30E-06 NA mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 9.17E-32 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 2.27E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 7.90E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 1.35E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 1.05E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 1.26E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 1.42E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 2.48E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 4.74E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 6.05E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 2.45E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 9.68E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 3.04E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 9.79E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 2.96E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414510569 NA 1.21E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251