Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0414236394:

Variant ID: vg0414236394 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14236394
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAGCTCACGTACCTGCTGGAGTTTTAGCCCTGAGGAAGAAAGAATTCCGTGAACTCAAGCAAGATGGCAGGACCGTCACTGAATTTTTGCACGAGTTCAA[T/C]
AGGTTGGCCCGCTATGCTCCCGAGGACGTTCGCACCGATGAAGAGAAGCAAGAGAAATATCTTGAAGGGTTGAATGATGAATTGTCAATCCATCTCATCT

Reverse complement sequence

AGATGAGATGGATTGACAATTCATCATTCAACCCTTCAAGATATTTCTCTTGCTTCTCTTCATCGGTGCGAACGTCCTCGGGAGCATAGCGGGCCAACCT[A/G]
TTGAACTCGTGCAAAAATTCAGTGACGGTCCTGCCATCTTGCTTGAGTTCACGGAATTCTTTCTTCCTCAGGGCTAAAACTCCAGCAGGTACGTGAGCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.80%	26.70%	2.86%	20.63%	NA
All Indica	2759	67.30%	16.00%	3.41%	13.27%	NA
All Japonica	1512	8.60%	51.90%	1.06%	38.43%	NA
Aus	269	98.10%	1.10%	0.37%	0.37%	NA
Indica I	595	56.80%	26.20%	0.50%	16.47%	NA
Indica II	465	60.90%	22.20%	4.73%	12.26%	NA
Indica III	913	70.30%	11.20%	6.02%	12.49%	NA
Indica Intermediate	786	75.70%	10.20%	1.78%	12.34%	NA
Temperate Japonica	767	2.00%	89.70%	0.39%	7.95%	NA
Tropical Japonica	504	18.30%	4.80%	2.58%	74.40%	NA
Japonica Intermediate	241	9.50%	30.30%	0.00%	60.17%	NA
VI/Aromatic	96	59.40%	11.50%	21.88%	7.29%	NA
Intermediate	90	48.90%	25.60%	3.33%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414236394	T -> C	LOC_Os04g24780.1	synonymous_variant ; p.Asn312Asn; LOW	synonymous_codon	Average:16.758; most accessible tissue: Callus, score: 37.814	N	N	N	N
vg0414236394	T -> DEL	LOC_Os04g24780.1	N	frameshift_variant	Average:16.758; most accessible tissue: Callus, score: 37.814	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414236394	NA	1.34E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	4.33E-06	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	1.90E-06	mr1415	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	5.08E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	1.90E-06	mr1567	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	2.10E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	6.52E-07	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	9.50E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	3.63E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	2.21E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	4.98E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	2.89E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	7.40E-08	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	9.52E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	8.04E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	6.51E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	5.42E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	9.90E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	8.38E-09	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	7.17E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	7.95E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394	NA	1.03E-08	mr1793_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251