\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414236394:

Variant ID: vg0414236394 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14236394
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCTCACGTACCTGCTGGAGTTTTAGCCCTGAGGAAGAAAGAATTCCGTGAACTCAAGCAAGATGGCAGGACCGTCACTGAATTTTTGCACGAGTTCAA[T/C]
AGGTTGGCCCGCTATGCTCCCGAGGACGTTCGCACCGATGAAGAGAAGCAAGAGAAATATCTTGAAGGGTTGAATGATGAATTGTCAATCCATCTCATCT

Reverse complement sequence

AGATGAGATGGATTGACAATTCATCATTCAACCCTTCAAGATATTTCTCTTGCTTCTCTTCATCGGTGCGAACGTCCTCGGGAGCATAGCGGGCCAACCT[A/G]
TTGAACTCGTGCAAAAATTCAGTGACGGTCCTGCCATCTTGCTTGAGTTCACGGAATTCTTTCTTCCTCAGGGCTAAAACTCCAGCAGGTACGTGAGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 26.70% 2.86% 20.63% NA
All Indica  2759 67.30% 16.00% 3.41% 13.27% NA
All Japonica  1512 8.60% 51.90% 1.06% 38.43% NA
Aus  269 98.10% 1.10% 0.37% 0.37% NA
Indica I  595 56.80% 26.20% 0.50% 16.47% NA
Indica II  465 60.90% 22.20% 4.73% 12.26% NA
Indica III  913 70.30% 11.20% 6.02% 12.49% NA
Indica Intermediate  786 75.70% 10.20% 1.78% 12.34% NA
Temperate Japonica  767 2.00% 89.70% 0.39% 7.95% NA
Tropical Japonica  504 18.30% 4.80% 2.58% 74.40% NA
Japonica Intermediate  241 9.50% 30.30% 0.00% 60.17% NA
VI/Aromatic  96 59.40% 11.50% 21.88% 7.29% NA
Intermediate  90 48.90% 25.60% 3.33% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414236394 T -> C LOC_Os04g24780.1 synonymous_variant ; p.Asn312Asn; LOW synonymous_codon Average:16.758; most accessible tissue: Callus, score: 37.814 N N N N
vg0414236394 T -> DEL LOC_Os04g24780.1 N frameshift_variant Average:16.758; most accessible tissue: Callus, score: 37.814 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414236394 NA 1.34E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 4.33E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 1.90E-06 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 5.08E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 1.90E-06 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 2.10E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 6.52E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 9.50E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 3.63E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 2.21E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 4.98E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 2.89E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 7.40E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 9.52E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 8.04E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 6.51E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 5.42E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 9.90E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 8.38E-09 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 7.17E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 7.95E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414236394 NA 1.03E-08 mr1793_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251