\
| Variant ID: vg0414209097 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14209097 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 89. )
ACAAGACCCCCGAAGAAATTAGGATGACTCCCACACGGGAGTGGATTCTAATCCCTCAAGGGGATATCCCCTCGTATATCTTTTTTTTTCAAATTCGATG[T/C]
AAATAGTTGTGAAAAATTCTAAAAACAATTGACAATGTAGAGTATAATGATACCTATTAGTCCACCAAAATTCATGTTCAAATTCGATCTACACATCGAG
CTCGATGTGTAGATCGAATTTGAACATGAATTTTGGTGGACTAATAGGTATCATTATACTCTACATTGTCAATTGTTTTTAGAATTTTTCACAACTATTT[A/G]
CATCGAATTTGAAAAAAAAAGATATACGAGGGGATATCCCCTTGAGGGATTAGAATCCACTCCCGTGTGGGAGTCATCCTAATTTCTTCGGGGGTCTTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.00% | 31.20% | 1.52% | 32.25% | NA |
| All Indica | 2759 | 11.90% | 42.80% | 2.03% | 43.24% | NA |
| All Japonica | 1512 | 84.80% | 13.80% | 0.73% | 0.73% | NA |
| Aus | 269 | 0.40% | 4.50% | 0.00% | 95.17% | NA |
| Indica I | 595 | 35.50% | 33.90% | 1.68% | 28.91% | NA |
| Indica II | 465 | 4.30% | 27.50% | 3.66% | 64.52% | NA |
| Indica III | 913 | 2.50% | 60.60% | 1.31% | 35.60% | NA |
| Indica Intermediate | 786 | 9.50% | 37.90% | 2.16% | 50.38% | NA |
| Temperate Japonica | 767 | 96.30% | 3.30% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 78.80% | 19.00% | 1.59% | 0.60% | NA |
| Japonica Intermediate | 241 | 60.60% | 36.10% | 1.24% | 2.07% | NA |
| VI/Aromatic | 96 | 10.40% | 47.90% | 1.04% | 40.62% | NA |
| Intermediate | 90 | 35.60% | 32.20% | 4.44% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414209097 | T -> C | LOC_Os04g24750.1 | upstream_gene_variant ; 476.0bp to feature; MODIFIER | silent_mutation | Average:51.575; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0414209097 | T -> C | LOC_Os04g24730-LOC_Os04g24750 | intergenic_region ; MODIFIER | silent_mutation | Average:51.575; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0414209097 | T -> DEL | N | N | silent_mutation | Average:51.575; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414209097 | NA | 7.28E-06 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | NA | 1.85E-07 | mr1066 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | 6.55E-06 | NA | mr1173 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | 5.23E-06 | 8.03E-10 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | NA | 3.52E-06 | mr1298 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | NA | 3.79E-06 | mr1318 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | 9.58E-06 | 2.79E-07 | mr1337 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | NA | 9.60E-06 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | 2.11E-06 | 1.28E-07 | mr1380 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | NA | 6.73E-06 | mr1510 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | 4.41E-07 | 2.54E-10 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | 4.61E-06 | 5.01E-09 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | 3.53E-06 | 3.52E-06 | mr1899 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | 6.69E-06 | 6.69E-06 | mr1899 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | NA | 4.04E-06 | mr1937 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414209097 | 1.62E-06 | 1.62E-06 | mr1651_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |