\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414209097:

Variant ID: vg0414209097 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14209097
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGACCCCCGAAGAAATTAGGATGACTCCCACACGGGAGTGGATTCTAATCCCTCAAGGGGATATCCCCTCGTATATCTTTTTTTTTCAAATTCGATG[T/C]
AAATAGTTGTGAAAAATTCTAAAAACAATTGACAATGTAGAGTATAATGATACCTATTAGTCCACCAAAATTCATGTTCAAATTCGATCTACACATCGAG

Reverse complement sequence

CTCGATGTGTAGATCGAATTTGAACATGAATTTTGGTGGACTAATAGGTATCATTATACTCTACATTGTCAATTGTTTTTAGAATTTTTCACAACTATTT[A/G]
CATCGAATTTGAAAAAAAAAGATATACGAGGGGATATCCCCTTGAGGGATTAGAATCCACTCCCGTGTGGGAGTCATCCTAATTTCTTCGGGGGTCTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.00% 31.20% 1.52% 32.25% NA
All Indica  2759 11.90% 42.80% 2.03% 43.24% NA
All Japonica  1512 84.80% 13.80% 0.73% 0.73% NA
Aus  269 0.40% 4.50% 0.00% 95.17% NA
Indica I  595 35.50% 33.90% 1.68% 28.91% NA
Indica II  465 4.30% 27.50% 3.66% 64.52% NA
Indica III  913 2.50% 60.60% 1.31% 35.60% NA
Indica Intermediate  786 9.50% 37.90% 2.16% 50.38% NA
Temperate Japonica  767 96.30% 3.30% 0.00% 0.39% NA
Tropical Japonica  504 78.80% 19.00% 1.59% 0.60% NA
Japonica Intermediate  241 60.60% 36.10% 1.24% 2.07% NA
VI/Aromatic  96 10.40% 47.90% 1.04% 40.62% NA
Intermediate  90 35.60% 32.20% 4.44% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414209097 T -> C LOC_Os04g24750.1 upstream_gene_variant ; 476.0bp to feature; MODIFIER silent_mutation Average:51.575; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0414209097 T -> C LOC_Os04g24730-LOC_Os04g24750 intergenic_region ; MODIFIER silent_mutation Average:51.575; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg0414209097 T -> DEL N N silent_mutation Average:51.575; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414209097 NA 7.28E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 NA 1.85E-07 mr1066 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 6.55E-06 NA mr1173 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 5.23E-06 8.03E-10 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 NA 3.52E-06 mr1298 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 NA 3.79E-06 mr1318 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 9.58E-06 2.79E-07 mr1337 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 NA 9.60E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 2.11E-06 1.28E-07 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 NA 6.73E-06 mr1510 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 4.41E-07 2.54E-10 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 4.61E-06 5.01E-09 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 3.53E-06 3.52E-06 mr1899 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 6.69E-06 6.69E-06 mr1899 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 NA 4.04E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414209097 1.62E-06 1.62E-06 mr1651_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251