\
| Variant ID: vg0414197719 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14197719 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 82. )
TTACATAAATGTGGAACTAGTTCAGTATTTATAAATGATGTGCAACTGGTTCATTATTTCTAACAAATGTGCATCTTGTTAAATACTCTTAATAAATGTG[T/C]
AACTGGTTAAATAATTTTAATTGCCTTGATTATTTGTGGAACAGGCGGAATTTGTTGAGCATGTTCACGTGGAGTCCGACACCCTACTGCAAAGACTAGA
TCTAGTCTTTGCAGTAGGGTGTCGGACTCCACGTGAACATGCTCAACAAATTCCGCCTGTTCCACAAATAATCAAGGCAATTAAAATTATTTAACCAGTT[A/G]
CACATTTATTAAGAGTATTTAACAAGATGCACATTTGTTAGAAATAATGAACCAGTTGCACATCATTTATAAATACTGAACTAGTTCCACATTTATGTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 13.80% | 11.80% | 4.89% | 69.47% | NA |
| All Indica | 2759 | 7.40% | 4.30% | 3.23% | 85.07% | NA |
| All Japonica | 1512 | 28.20% | 21.20% | 5.62% | 44.91% | NA |
| Aus | 269 | 0.40% | 37.90% | 7.43% | 54.28% | NA |
| Indica I | 595 | 23.50% | 9.40% | 3.70% | 63.36% | NA |
| Indica II | 465 | 0.90% | 1.70% | 3.01% | 94.41% | NA |
| Indica III | 913 | 1.60% | 3.20% | 2.63% | 92.55% | NA |
| Indica Intermediate | 786 | 5.70% | 3.30% | 3.69% | 87.28% | NA |
| Temperate Japonica | 767 | 46.00% | 40.20% | 7.17% | 6.65% | NA |
| Tropical Japonica | 504 | 2.40% | 0.20% | 1.59% | 95.83% | NA |
| Japonica Intermediate | 241 | 25.70% | 5.00% | 9.13% | 60.17% | NA |
| VI/Aromatic | 96 | 9.40% | 6.20% | 31.25% | 53.12% | NA |
| Intermediate | 90 | 13.30% | 12.20% | 7.78% | 66.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414197719 | T -> C | LOC_Os04g24730.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.253; most accessible tissue: Callus, score: 18.519 | N | N | N | N |
| vg0414197719 | T -> DEL | N | N | silent_mutation | Average:7.253; most accessible tissue: Callus, score: 18.519 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414197719 | NA | 8.63E-09 | mr1054 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 2.90E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 4.44E-08 | mr1287 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 2.79E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 3.56E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 6.35E-06 | mr1353 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 5.21E-08 | mr1372 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 9.37E-07 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 1.94E-09 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 7.29E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 2.75E-07 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 7.30E-06 | mr1433 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 2.41E-07 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 9.47E-06 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 2.61E-07 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 2.29E-08 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 7.30E-07 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 1.76E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 3.83E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 1.74E-11 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414197719 | NA | 2.54E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |