\
| Variant ID: vg0414170889 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14170889 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 218. )
ATACTTTTCCTTCATCCGTGATCTTCGGAGTTCTAGCTCTTACCTAGTTCCTTGATCTTTGTGTCCACTCCTCCATTGGTACCGGTTGCCCCTTCTTCCT[C/T]
ATTTCCTCCTCCTCTTTTGTCCACTGCTCCACCTTTGGTGCATATCCCGCGGAGCCTAAGTGATGAGGAAATTTGTTCTTCTTGGCCAACTCTGCAAACA
TGTTTGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCACTTAGGCTCCGCGGGATATGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAAT[G/A]
AGGAAGAAGGGGCAACCGGTACCAATGGAGGAGTGGACACAAAGATCAAGGAACTAGGTAAGAGCTAGAACTCCGAAGATCACGGATGAAGGAAAAGTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.20% | 33.60% | 6.18% | 1.06% | NA |
| All Indica | 2759 | 56.70% | 38.90% | 2.65% | 1.78% | NA |
| All Japonica | 1512 | 57.90% | 28.00% | 14.02% | 0.07% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.70% | 33.90% | 1.34% | 0.00% | NA |
| Indica II | 465 | 74.80% | 11.40% | 4.09% | 9.68% | NA |
| Indica III | 913 | 38.00% | 59.40% | 2.63% | 0.00% | NA |
| Indica Intermediate | 786 | 61.60% | 35.10% | 2.80% | 0.51% | NA |
| Temperate Japonica | 767 | 94.50% | 4.80% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 8.50% | 57.10% | 34.33% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.40% | 41.10% | 14.11% | 0.41% | NA |
| VI/Aromatic | 96 | 50.00% | 47.90% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 35.60% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414170889 | C -> DEL | N | N | silent_mutation | Average:34.413; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0414170889 | C -> T | LOC_Os04g24690.1 | 3_prime_UTR_variant ; 980.0bp to feature; MODIFIER | silent_mutation | Average:34.413; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0414170889 | C -> T | LOC_Os04g24680.1 | upstream_gene_variant ; 2855.0bp to feature; MODIFIER | silent_mutation | Average:34.413; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414170889 | NA | 2.10E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414170889 | 2.13E-06 | 4.75E-07 | mr1088 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414170889 | NA | 4.68E-06 | mr1131 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414170889 | NA | 7.27E-06 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414170889 | NA | 2.51E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414170889 | NA | 1.02E-06 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414170889 | NA | 1.05E-06 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414170889 | NA | 1.34E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414170889 | 6.54E-07 | 2.08E-10 | mr1715 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414170889 | NA | 1.62E-07 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414170889 | NA | 5.22E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |