\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414170889:

Variant ID: vg0414170889 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14170889
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTTTTCCTTCATCCGTGATCTTCGGAGTTCTAGCTCTTACCTAGTTCCTTGATCTTTGTGTCCACTCCTCCATTGGTACCGGTTGCCCCTTCTTCCT[C/T]
ATTTCCTCCTCCTCTTTTGTCCACTGCTCCACCTTTGGTGCATATCCCGCGGAGCCTAAGTGATGAGGAAATTTGTTCTTCTTGGCCAACTCTGCAAACA

Reverse complement sequence

TGTTTGCAGAGTTGGCCAAGAAGAACAAATTTCCTCATCACTTAGGCTCCGCGGGATATGCACCAAAGGTGGAGCAGTGGACAAAAGAGGAGGAGGAAAT[G/A]
AGGAAGAAGGGGCAACCGGTACCAATGGAGGAGTGGACACAAAGATCAAGGAACTAGGTAAGAGCTAGAACTCCGAAGATCACGGATGAAGGAAAAGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 33.60% 6.18% 1.06% NA
All Indica  2759 56.70% 38.90% 2.65% 1.78% NA
All Japonica  1512 57.90% 28.00% 14.02% 0.07% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 64.70% 33.90% 1.34% 0.00% NA
Indica II  465 74.80% 11.40% 4.09% 9.68% NA
Indica III  913 38.00% 59.40% 2.63% 0.00% NA
Indica Intermediate  786 61.60% 35.10% 2.80% 0.51% NA
Temperate Japonica  767 94.50% 4.80% 0.65% 0.00% NA
Tropical Japonica  504 8.50% 57.10% 34.33% 0.00% NA
Japonica Intermediate  241 44.40% 41.10% 14.11% 0.41% NA
VI/Aromatic  96 50.00% 47.90% 2.08% 0.00% NA
Intermediate  90 58.90% 35.60% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414170889 C -> DEL N N silent_mutation Average:34.413; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0414170889 C -> T LOC_Os04g24690.1 3_prime_UTR_variant ; 980.0bp to feature; MODIFIER silent_mutation Average:34.413; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0414170889 C -> T LOC_Os04g24680.1 upstream_gene_variant ; 2855.0bp to feature; MODIFIER silent_mutation Average:34.413; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414170889 NA 2.10E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414170889 2.13E-06 4.75E-07 mr1088 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414170889 NA 4.68E-06 mr1131 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414170889 NA 7.27E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414170889 NA 2.51E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414170889 NA 1.02E-06 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414170889 NA 1.05E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414170889 NA 1.34E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414170889 6.54E-07 2.08E-10 mr1715 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414170889 NA 1.62E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414170889 NA 5.22E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251