Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414021996:

Variant ID: vg0414021996 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14021996
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

CGGATTTGAGATATTTTTATAAAAACGGAACCTACATGATATGAGCAATCCATTTTTGAGATGATCCAATTTTAGTTTTGCACTTTGCGTTTGAGTCCCT[G/A]
TAATATTCATATTTACATTTGAGTCCTTATAATATTGATATTTACATTTGAGTCCCTGTTCGAGGTCAGTGGTCAGCTCTTGTTGAAAAAAAAAGTAAAA

Reverse complement sequence

TTTTACTTTTTTTTTCAACAAGAGCTGACCACTGACCTCGAACAGGGACTCAAATGTAAATATCAATATTATAAGGACTCAAATGTAAATATGAATATTA[C/T]
AGGGACTCAAACGCAAAGTGCAAAACTAAAATTGGATCATCTCAAAAATGGATTGCTCATATCATGTAGGTTCCGTTTTTATAAAAATATCTCAAATCCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	23.70%	0.44%	3.47%	NA
All Indica	2759	61.40%	34.70%	0.69%	3.19%	NA
All Japonica	1512	94.30%	0.70%	0.07%	4.96%	NA
Aus	269	53.20%	46.50%	0.37%	0.00%	NA
Indica I	595	80.70%	17.10%	1.18%	1.01%	NA
Indica II	465	48.80%	50.50%	0.43%	0.22%	NA
Indica III	913	54.80%	38.60%	0.11%	6.57%	NA
Indica Intermediate	786	62.10%	34.10%	1.15%	2.67%	NA
Temperate Japonica	767	98.30%	0.10%	0.00%	1.56%	NA
Tropical Japonica	504	98.40%	1.00%	0.00%	0.60%	NA
Japonica Intermediate	241	73.00%	1.70%	0.41%	24.90%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	70.00%	28.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414021996	G -> DEL	N	N	silent_mutation	Average:34.029; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0414021996	G -> A	LOC_Os04g24440.1	upstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:34.029; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N
vg0414021996	G -> A	LOC_Os04g24450.1	intron_variant ; MODIFIER	silent_mutation	Average:34.029; most accessible tissue: Minghui63 flag leaf, score: 49.097	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414021996	NA	8.47E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	1.22E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	2.64E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	1.78E-07	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	4.15E-15	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	9.14E-11	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	7.95E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	1.94E-07	mr1304_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	6.84E-07	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	8.48E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	3.05E-07	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	3.04E-18	mr1830_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	NA	3.26E-16	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	2.54E-07	2.41E-30	mr1846_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414021996	6.49E-08	2.69E-26	mr1846_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251