\
| Variant ID: vg0413981432 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13981432 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGGTCTTTTCTGGACTATAGGAAAAAAAAATTAATGGCGAAGGGAAGGGTAAATTCTCTCACCGATGAACCACGCTCTGATACCACCTGATGCGAACACG[C/G]
TAGGGTTTGTGGCCCGATCTTTCGATGAGAGGTAAGGGATAACTCGATTAGATGAAGTCGACGTTCACAGCCCGACTACAACGGTCCAAAGACGCTGCGC
GCGCAGCGTCTTTGGACCGTTGTAGTCGGGCTGTGAACGTCGACTTCATCTAATCGAGTTATCCCTTACCTCTCATCGAAAGATCGGGCCACAAACCCTA[G/C]
CGTGTTCGCATCAGGTGGTATCAGAGCGTGGTTCATCGGTGAGAGAATTTACCCTTCCCTTCGCCATTAATTTTTTTTTCCTATAGTCCAGAAAAGACCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.30% | 9.20% | 7.41% | 0.02% | NA |
| All Indica | 2759 | 82.20% | 9.40% | 8.45% | 0.04% | NA |
| All Japonica | 1512 | 95.10% | 0.10% | 4.83% | 0.00% | NA |
| Aus | 269 | 22.70% | 63.90% | 13.38% | 0.00% | NA |
| Indica I | 595 | 97.60% | 1.20% | 1.01% | 0.17% | NA |
| Indica II | 465 | 67.10% | 13.50% | 19.35% | 0.00% | NA |
| Indica III | 913 | 78.30% | 13.60% | 8.11% | 0.00% | NA |
| Indica Intermediate | 786 | 83.80% | 8.10% | 8.02% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 0.00% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.70% | 0.40% | 24.90% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 4.40% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413981432 | C -> DEL | N | N | silent_mutation | Average:8.425; most accessible tissue: Callus, score: 26.321 | N | N | N | N |
| vg0413981432 | C -> G | LOC_Os04g24370.1 | upstream_gene_variant ; 1270.0bp to feature; MODIFIER | silent_mutation | Average:8.425; most accessible tissue: Callus, score: 26.321 | N | N | N | N |
| vg0413981432 | C -> G | LOC_Os04g24390.1 | upstream_gene_variant ; 2760.0bp to feature; MODIFIER | silent_mutation | Average:8.425; most accessible tissue: Callus, score: 26.321 | N | N | N | N |
| vg0413981432 | C -> G | LOC_Os04g24380.1 | downstream_gene_variant ; 65.0bp to feature; MODIFIER | silent_mutation | Average:8.425; most accessible tissue: Callus, score: 26.321 | N | N | N | N |
| vg0413981432 | C -> G | LOC_Os04g24370-LOC_Os04g24380 | intergenic_region ; MODIFIER | silent_mutation | Average:8.425; most accessible tissue: Callus, score: 26.321 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413981432 | NA | 6.18E-07 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 1.30E-07 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 6.14E-07 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 2.11E-09 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 4.58E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 5.30E-06 | mr1609 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 6.79E-07 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 2.49E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 7.15E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 7.95E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 2.97E-08 | mr1892_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413981432 | NA | 7.64E-06 | mr1892_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |