\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413981432:

Variant ID: vg0413981432 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13981432
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTCTTTTCTGGACTATAGGAAAAAAAAATTAATGGCGAAGGGAAGGGTAAATTCTCTCACCGATGAACCACGCTCTGATACCACCTGATGCGAACACG[C/G]
TAGGGTTTGTGGCCCGATCTTTCGATGAGAGGTAAGGGATAACTCGATTAGATGAAGTCGACGTTCACAGCCCGACTACAACGGTCCAAAGACGCTGCGC

Reverse complement sequence

GCGCAGCGTCTTTGGACCGTTGTAGTCGGGCTGTGAACGTCGACTTCATCTAATCGAGTTATCCCTTACCTCTCATCGAAAGATCGGGCCACAAACCCTA[G/C]
CGTGTTCGCATCAGGTGGTATCAGAGCGTGGTTCATCGGTGAGAGAATTTACCCTTCCCTTCGCCATTAATTTTTTTTTCCTATAGTCCAGAAAAGACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 9.20% 7.41% 0.02% NA
All Indica  2759 82.20% 9.40% 8.45% 0.04% NA
All Japonica  1512 95.10% 0.10% 4.83% 0.00% NA
Aus  269 22.70% 63.90% 13.38% 0.00% NA
Indica I  595 97.60% 1.20% 1.01% 0.17% NA
Indica II  465 67.10% 13.50% 19.35% 0.00% NA
Indica III  913 78.30% 13.60% 8.11% 0.00% NA
Indica Intermediate  786 83.80% 8.10% 8.02% 0.00% NA
Temperate Japonica  767 98.60% 0.00% 1.43% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 74.70% 0.40% 24.90% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 87.80% 4.40% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413981432 C -> DEL N N silent_mutation Average:8.425; most accessible tissue: Callus, score: 26.321 N N N N
vg0413981432 C -> G LOC_Os04g24370.1 upstream_gene_variant ; 1270.0bp to feature; MODIFIER silent_mutation Average:8.425; most accessible tissue: Callus, score: 26.321 N N N N
vg0413981432 C -> G LOC_Os04g24390.1 upstream_gene_variant ; 2760.0bp to feature; MODIFIER silent_mutation Average:8.425; most accessible tissue: Callus, score: 26.321 N N N N
vg0413981432 C -> G LOC_Os04g24380.1 downstream_gene_variant ; 65.0bp to feature; MODIFIER silent_mutation Average:8.425; most accessible tissue: Callus, score: 26.321 N N N N
vg0413981432 C -> G LOC_Os04g24370-LOC_Os04g24380 intergenic_region ; MODIFIER silent_mutation Average:8.425; most accessible tissue: Callus, score: 26.321 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413981432 NA 6.18E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 1.30E-07 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 6.14E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 2.11E-09 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 4.58E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 5.30E-06 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 6.79E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 2.49E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 7.15E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 7.95E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 2.97E-08 mr1892_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413981432 NA 7.64E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251