\
| Variant ID: vg0413759612 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13759612 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGGCAGGGGATGGGTGGGGAAGGGGAGGAGGCGGAGGGGGAGGAGGAGAGAGATCGATCTGAGAGGAGGAGGGGAGGAGGAGAGGGAGATCGATCTGAGC[C/G]
GATGGGAAGGGAGTACGGGGAGGAGAGGGCCGGGGATGGGAGGAGGAAGGGGAGAAGGCGGAGGCGGAGGAGGAGAGGGAGATCGATCTGAGAGGGAGGA
TCCTCCCTCTCAGATCGATCTCCCTCTCCTCCTCCGCCTCCGCCTTCTCCCCTTCCTCCTCCCATCCCCGGCCCTCTCCTCCCCGTACTCCCTTCCCATC[G/C]
GCTCAGATCGATCTCCCTCTCCTCCTCCCCTCCTCCTCTCAGATCGATCTCTCTCCTCCTCCCCCTCCGCCTCCTCCCCTTCCCCACCCATCCCCTGCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.80% | 3.80% | 9.84% | 7.49% | NA |
| All Indica | 2759 | 75.90% | 4.00% | 11.49% | 8.59% | NA |
| All Japonica | 1512 | 91.30% | 2.80% | 4.56% | 1.32% | NA |
| Aus | 269 | 56.10% | 0.40% | 11.90% | 31.60% | NA |
| Indica I | 595 | 77.00% | 3.00% | 12.94% | 7.06% | NA |
| Indica II | 465 | 60.00% | 14.80% | 16.77% | 8.39% | NA |
| Indica III | 913 | 82.40% | 0.40% | 7.45% | 9.75% | NA |
| Indica Intermediate | 786 | 77.00% | 2.50% | 11.96% | 8.52% | NA |
| Temperate Japonica | 767 | 98.30% | 0.30% | 1.30% | 0.13% | NA |
| Tropical Japonica | 504 | 86.70% | 4.40% | 6.94% | 1.98% | NA |
| Japonica Intermediate | 241 | 78.40% | 7.90% | 9.96% | 3.73% | NA |
| VI/Aromatic | 96 | 42.70% | 19.80% | 31.25% | 6.25% | NA |
| Intermediate | 90 | 66.70% | 7.80% | 18.89% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413759612 | C -> DEL | N | N | silent_mutation | Average:56.874; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
| vg0413759612 | C -> G | LOC_Os04g24090.1 | downstream_gene_variant ; 994.0bp to feature; MODIFIER | silent_mutation | Average:56.874; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
| vg0413759612 | C -> G | LOC_Os04g24100.1 | downstream_gene_variant ; 2944.0bp to feature; MODIFIER | silent_mutation | Average:56.874; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
| vg0413759612 | C -> G | LOC_Os04g24080-LOC_Os04g24090 | intergenic_region ; MODIFIER | silent_mutation | Average:56.874; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413759612 | 6.23E-08 | NA | mr1584 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 1.81E-06 | NA | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 2.76E-06 | NA | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 1.93E-09 | NA | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 3.22E-08 | 3.69E-11 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 2.15E-06 | NA | mr1368_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 1.24E-14 | NA | mr1730_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 1.30E-09 | 1.30E-09 | mr1730_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 1.59E-07 | 1.92E-08 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 5.23E-06 | NA | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 1.43E-11 | NA | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413759612 | 4.66E-07 | 3.03E-06 | mr1866_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |