Variant ID: vg0413668647 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 13668647 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 101. )
ACATGTAGGCCCCACATTTTTTATATAGAATGCTGACTGGACTGCCACGCGTACGCCACGTAGACCAAAACCACCGTGGATTGGGTCGAGGGGGGTAATT[C/T]
GTCCAGTTTGTATAGTTCGGGGTGAAAAATGTCCGGTTTTGTGGTTTAGGGGGGTAATTCAGATGACCGCGATAGTTCGGGGGTTAATTCGTACTTTTTC
GAAAAAGTACGAATTAACCCCCGAACTATCGCGGTCATCTGAATTACCCCCCTAAACCACAAAACCGGACATTTTTCACCCCGAACTATACAAACTGGAC[G/A]
AATTACCCCCCTCGACCCAATCCACGGTGGTTTTGGTCTACGTGGCGTACGCGTGGCAGTCCAGTCAGCATTCTATATAAAAAATGTGGGGCCTACATGT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 68.50% | 30.90% | 0.63% | 0.02% | NA |
All Indica | 2759 | 96.50% | 2.40% | 1.05% | 0.04% | NA |
All Japonica | 1512 | 12.00% | 88.00% | 0.00% | 0.00% | NA |
Aus | 269 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.70% | 1.20% | 0.17% | 0.00% | NA |
Indica II | 465 | 95.90% | 1.90% | 1.94% | 0.22% | NA |
Indica III | 913 | 96.60% | 2.20% | 1.20% | 0.00% | NA |
Indica Intermediate | 786 | 95.20% | 3.80% | 1.02% | 0.00% | NA |
Temperate Japonica | 767 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 18.10% | 81.90% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 31.10% | 68.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
Intermediate | 90 | 61.10% | 37.80% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0413668647 | C -> DEL | N | N | silent_mutation | Average:38.299; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
vg0413668647 | C -> T | LOC_Os04g23910.1 | upstream_gene_variant ; 4063.0bp to feature; MODIFIER | silent_mutation | Average:38.299; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
vg0413668647 | C -> T | LOC_Os04g23890-LOC_Os04g23910 | intergenic_region ; MODIFIER | silent_mutation | Average:38.299; most accessible tissue: Minghui63 young leaf, score: 51.901 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0413668647 | NA | 3.53E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0413668647 | NA | 8.46E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0413668647 | NA | 4.43E-21 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0413668647 | 2.27E-07 | 1.67E-30 | mr1350_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0413668647 | 2.69E-06 | 9.27E-11 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0413668647 | NA | 1.43E-17 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0413668647 | 1.20E-07 | 9.84E-09 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |