Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0413440235:

Variant ID: vg0413440235 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 13440235
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTTGAGCGCGCGACGGCGGCCACGGGGTGGCCTCGGCCGGTCAAGCAGAGGAAGATGAGGATGCAAAGGAGCATACGAAGAGGAGGAGAGGAGCAGACG[G/A]
ACAAGAGGATGAGGATGCGGAGGCGAGGTGGGAGGAGAGGAGGAGAGTGGCCATGGCGGCAACGAAGGTGGACGTGGATCTAACAGGAAGGACAGAAAAG

Reverse complement sequence

CTTTTCTGTCCTTCCTGTTAGATCCACGTCCACCTTCGTTGCCGCCATGGCCACTCTCCTCCTCTCCTCCCACCTCGCCTCCGCATCCTCATCCTCTTGT[C/T]
CGTCTGCTCCTCTCCTCCTCTTCGTATGCTCCTTTGCATCCTCATCTTCCTCTGCTTGACCGGCCGAGGCCACCCCGTGGCCGCCGTCGCGCGCTCAAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	8.70%	0.08%	0.00%	NA
All Indica	2759	94.90%	5.10%	0.00%	0.00%	NA
All Japonica	1512	88.10%	11.70%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	85.00%	15.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	95.40%	4.60%	0.00%	0.00%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	80.20%	19.60%	0.20%	0.00%	NA
Japonica Intermediate	241	73.40%	25.70%	0.83%	0.00%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	80.00%	18.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0413440235	G -> A	LOC_Os04g23500.1	upstream_gene_variant ; 2520.0bp to feature; MODIFIER	silent_mutation	Average:68.344; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0413440235	G -> A	LOC_Os04g23510.1	downstream_gene_variant ; 853.0bp to feature; MODIFIER	silent_mutation	Average:68.344; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N
vg0413440235	G -> A	LOC_Os04g23510-LOC_Os04g23520	intergenic_region ; MODIFIER	silent_mutation	Average:68.344; most accessible tissue: Zhenshan97 young leaf, score: 80.589	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0413440235	2.83E-06	3.49E-08	mr1042	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	5.01E-07	1.38E-08	mr1043	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	1.25E-06	8.72E-08	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	NA	3.21E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	NA	7.03E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	8.34E-08	9.20E-10	mr1912	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	NA	3.71E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	NA	7.24E-06	mr1043_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	9.56E-07	NA	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	NA	8.22E-10	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	NA	5.70E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	3.14E-09	NA	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	5.29E-07	3.15E-08	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235	1.83E-07	NA	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251