\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0413440235:

Variant ID: vg0413440235 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 13440235
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTGAGCGCGCGACGGCGGCCACGGGGTGGCCTCGGCCGGTCAAGCAGAGGAAGATGAGGATGCAAAGGAGCATACGAAGAGGAGGAGAGGAGCAGACG[G/A]
ACAAGAGGATGAGGATGCGGAGGCGAGGTGGGAGGAGAGGAGGAGAGTGGCCATGGCGGCAACGAAGGTGGACGTGGATCTAACAGGAAGGACAGAAAAG

Reverse complement sequence

CTTTTCTGTCCTTCCTGTTAGATCCACGTCCACCTTCGTTGCCGCCATGGCCACTCTCCTCCTCTCCTCCCACCTCGCCTCCGCATCCTCATCCTCTTGT[C/T]
CGTCTGCTCCTCTCCTCCTCTTCGTATGCTCCTTTGCATCCTCATCTTCCTCTGCTTGACCGGCCGAGGCCACCCCGTGGCCGCCGTCGCGCGCTCAAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.70% 0.08% 0.00% NA
All Indica  2759 94.90% 5.10% 0.00% 0.00% NA
All Japonica  1512 88.10% 11.70% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.00% 15.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 80.20% 19.60% 0.20% 0.00% NA
Japonica Intermediate  241 73.40% 25.70% 0.83% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0413440235 G -> A LOC_Os04g23500.1 upstream_gene_variant ; 2520.0bp to feature; MODIFIER silent_mutation Average:68.344; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg0413440235 G -> A LOC_Os04g23510.1 downstream_gene_variant ; 853.0bp to feature; MODIFIER silent_mutation Average:68.344; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg0413440235 G -> A LOC_Os04g23510-LOC_Os04g23520 intergenic_region ; MODIFIER silent_mutation Average:68.344; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0413440235 2.83E-06 3.49E-08 mr1042 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 5.01E-07 1.38E-08 mr1043 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 1.25E-06 8.72E-08 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 NA 3.21E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 NA 7.03E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 8.34E-08 9.20E-10 mr1912 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 NA 3.71E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 NA 7.24E-06 mr1043_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 9.56E-07 NA mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 NA 8.22E-10 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 NA 5.70E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 3.14E-09 NA mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 5.29E-07 3.15E-08 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0413440235 1.83E-07 NA mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251