\
| Variant ID: vg0413423284 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13423284 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 322. )
AACATTATTTGCCGTTTCGGAGTGCCGAAAGAGTTCATCACTGATAACGGCAAGCAATTCGACTCCAACAAATTCAAAGAAATGTGCAAGGGCTAAACCT[G/A]
GAAATCAGGTTCGCCTCAGTCGCGCACCCACAGTCAAATGGGGCGGCTGAGCGCACAAATGGCAAAATTCTTGAGGTGCTCAAAAAAAGGCTTGAGGGGG
CCCCCTCAAGCCTTTTTTTGAGCACCTCAAGAATTTTGCCATTTGTGCGCTCAGCCGCCCCATTTGACTGTGGGTGCGCGACTGAGGCGAACCTGATTTC[C/T]
AGGTTTAGCCCTTGCACATTTCTTTGAATTTGTTGGAGTCGAATTGCTTGCCGTTATCAGTGATGAACTCTTTCGGCACTCCGAAACGGCAAATAATGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 5.70% | 0.06% | 3.72% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.00% | 0.11% | NA |
| All Japonica | 1512 | 71.80% | 16.70% | 0.20% | 11.31% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 97.70% | 2.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 28.40% | 40.10% | 0.40% | 31.15% | NA |
| Japonica Intermediate | 241 | 80.50% | 14.10% | 0.41% | 4.98% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 8.90% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413423284 | G -> DEL | LOC_Os04g23480.1 | N | frameshift_variant | Average:52.796; most accessible tissue: Minghui63 young leaf, score: 75.937 | N | N | N | N |
| vg0413423284 | G -> A | LOC_Os04g23480.1 | synonymous_variant ; p.Leu239Leu; LOW | synonymous_codon | Average:52.796; most accessible tissue: Minghui63 young leaf, score: 75.937 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413423284 | NA | 5.66E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 2.73E-07 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 6.61E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 5.70E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 1.21E-20 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | 9.31E-10 | 6.65E-22 | mr1410 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 1.01E-12 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 2.63E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 2.63E-08 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 1.83E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 8.04E-08 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 2.63E-11 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 2.02E-09 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 7.59E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 1.30E-22 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | 6.33E-07 | 3.19E-21 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 1.08E-11 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 5.01E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413423284 | NA | 6.97E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |