Search for Variation information by Variation ID:
Detailed information for vg0413382898:
| Variant ID: vg0413382898 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 13382898 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TTTGGCTTCCTGTGTCCATACAAATTTGTCTTGCTTTTTTAGAAGTGCAAAGAAGGGCTGTCTTTGTTCTCCCATCCTAGCGACGAACCTACTTAGCGCC[A/G]
CCATGCATCCGGTTAGCTTCTGTACTTCCTTGAGTCTTGTGGGCGACTTCATGTTCACGATTGCCTTGATCTTCTCGGGATTTGCTTCTATTCCTCTGCA
Reverse complement sequence
TGCAGAGGAATAGAAGCAAATCCCGAGAAGATCAAGGCAATCGTGAACATGAAGTCGCCCACAAGACTCAAGGAAGTACAGAAGCTAACCGGATGCATGG[T/C]
GGCGCTAAGTAGGTTCGTCGCTAGGATGGGAGAACAAAGACAGCCCTTCTTTGCACTTCTAAAAAAGCAAGACAAATTTGTATGGACACAGGAAGCCAAA
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.00% | 25.50% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 77.10% | 22.30% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 84.60% | 15.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 7.40% | 92.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 84.50% | 15.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 72.70% | 27.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 71.40% | 27.70% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 80.50% | 18.60% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.20% | 20.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 30.00% | 3.33% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0413382898 | A -> G | LOC_Os04g23400.1 | missense_variant ; p.Val40Ala; MODERATE | nonsynonymous_codon ; V40A | Average:19.027; most accessible tissue: Zhenshan97 young leaf, score: 28.271 | benign  |
-0.572 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0413382898 | NA | 1.64E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413382898 | 1.95E-06 | NA | mr1350_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413382898 | NA | 1.41E-08 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413382898 | 9.40E-07 | NA | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0413382898 | NA | 1.26E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |