\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412977243:

Variant ID: vg0412977243 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12977243
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, G: 0.40, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTTGTGTACATGTTCGCAACCTGGGTGTTTTGTGGTCCGCTAACATATGCTCCAATTTCTAGACCTCCTTTTTAATTTCGCAATCCTTCTTTACGTC[A/G]
CACAACATCTCACCAAGATCATCTGCACCATCGTTTTCTTCAACAGCTCCGTCTGCCTCGCCTGTTGTATTTTATGGAAGTCCATCGTATTGAGCCCAAT

Reverse complement sequence

ATTGGGCTCAATACGATGGACTTCCATAAAATACAACAGGCGAGGCAGACGGAGCTGTTGAAGAAAACGATGGTGCAGATGATCTTGGTGAGATGTTGTG[T/C]
GACGTAAAGAAGGATTGCGAAATTAAAAAGGAGGTCTAGAAATTGGAGCATATGTTAGCGGACCACAAAACACCCAGGTTGCGAACATGTACACAAAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 35.30% 0.06% 0.80% NA
All Indica  2759 96.40% 2.20% 0.04% 1.34% NA
All Japonica  1512 2.20% 97.60% 0.13% 0.07% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.30% 0.20% 0.00% 0.50% NA
Indica II  465 92.70% 6.90% 0.00% 0.43% NA
Indica III  913 96.90% 0.70% 0.00% 2.41% NA
Indica Intermediate  786 95.70% 2.90% 0.13% 1.27% NA
Temperate Japonica  767 2.20% 97.40% 0.26% 0.13% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412977243 A -> DEL N N silent_mutation Average:36.675; most accessible tissue: Callus, score: 62.155 N N N N
vg0412977243 A -> G LOC_Os04g22880.1 downstream_gene_variant ; 2304.0bp to feature; MODIFIER silent_mutation Average:36.675; most accessible tissue: Callus, score: 62.155 N N N N
vg0412977243 A -> G LOC_Os04g22880-LOC_Os04g22890 intergenic_region ; MODIFIER silent_mutation Average:36.675; most accessible tissue: Callus, score: 62.155 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412977243 NA 1.81E-33 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 9.83E-28 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 5.44E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 1.43E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 3.57E-22 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 7.95E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 2.75E-07 NA mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 7.31E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 5.63E-07 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 4.49E-54 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 1.27E-70 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 1.88E-24 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 4.70E-79 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 3.56E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 1.61E-61 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 1.49E-28 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 5.20E-33 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 1.18E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 1.17E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 3.27E-34 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 1.39E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 2.39E-08 NA mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 1.77E-07 NA mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 7.57E-68 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412977243 NA 1.08E-64 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251