\
| Variant ID: vg0412792403 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12792403 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTATATGCAAGGCCGACGTTGTCAAGTACATGCTATCGGCTCAAAAATTAAAAGGAAGGGTTGGAAAGTGGATATTTTCCTTAACCGAGTTTGATCTTC[T/G]
GTATGAGTCGCCGAAGGCGATTAAGGACAAGCAATAGCTGATTTTATTGTGGAACATCGTGATGACTTAGTCGGCTCGGTTGAAATAGTGCCATGGACTT
AAGTCCATGGCACTATTTCAACCGAGCCGACTAAGTCATCACGATGTTCCACAATAAAATCAGCTATTGCTTGTCCTTAATCGCCTTCGGCGACTCATAC[A/C]
GAAGATCAAACTCGGTTAAGGAAAATATCCACTTTCCAACCCTTCCTTTTAATTTTTGAGCCGATAGCATGTACTTGACAACGTCGGCCTTGCATATAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 1.90% | 0.47% | 45.13% | NA |
| All Indica | 2759 | 29.60% | 1.00% | 0.72% | 68.65% | NA |
| All Japonica | 1512 | 95.20% | 4.00% | 0.00% | 0.86% | NA |
| Aus | 269 | 27.50% | 0.00% | 0.74% | 71.75% | NA |
| Indica I | 595 | 57.60% | 0.00% | 0.50% | 41.85% | NA |
| Indica II | 465 | 34.60% | 4.30% | 0.43% | 60.65% | NA |
| Indica III | 913 | 5.70% | 0.10% | 0.99% | 93.21% | NA |
| Indica Intermediate | 786 | 33.30% | 0.80% | 0.76% | 65.14% | NA |
| Temperate Japonica | 767 | 97.30% | 2.30% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 79.70% | 17.40% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 65.60% | 3.30% | 0.00% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412792403 | T -> DEL | N | N | silent_mutation | Average:7.691; most accessible tissue: Callus, score: 30.713 | N | N | N | N |
| vg0412792403 | T -> G | LOC_Os04g22600.1 | upstream_gene_variant ; 3136.0bp to feature; MODIFIER | silent_mutation | Average:7.691; most accessible tissue: Callus, score: 30.713 | N | N | N | N |
| vg0412792403 | T -> G | LOC_Os04g22590.1 | downstream_gene_variant ; 192.0bp to feature; MODIFIER | silent_mutation | Average:7.691; most accessible tissue: Callus, score: 30.713 | N | N | N | N |
| vg0412792403 | T -> G | LOC_Os04g22590-LOC_Os04g22600 | intergenic_region ; MODIFIER | silent_mutation | Average:7.691; most accessible tissue: Callus, score: 30.713 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412792403 | 1.95E-06 | 1.95E-06 | mr1651 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412792403 | NA | 6.05E-06 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412792403 | NA | 9.61E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |