| Variant ID: vg0412755385 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 12755385 |
| Reference Allele: G | Alternative Allele: GA,T |
| Primary Allele: G | Secondary Allele: GA |
Inferred Ancestral Allele: Not determined.
GCCCGCCATTTATGTTTTATGTATTTCCAGAAATTTATTTATGACCTTTCTTAGCCATTAAAAATTGCTGGAAAATTATGGTCAATTATTTGATCACTCA[G/GA,T]
AAAATTATTTCTAGTTAAATGGAACCAACAGGAAGTTTAGCTAGAAAGAAATTAATGATATGATATTATATTTGACCAATGTTAATATGATTTCATGTCA
TGACATGAAATCATATTAACATTGGTCAAATATAATATCATATCATTAATTTCTTTCTAGCTAAACTTCCTGTTGGTTCCATTTAACTAGAAATAATTTT[C/TC,A]
TGAGTGATCAAATAATTGACCATAATTTTCCAGCAATTTTTAATGGCTAAGAAAGGTCATAAATAAATTTCTGGAAATACATAAAACATAAATGGCGGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of GA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.40% | 0.40% | 2.43% | 53.58% | T: 0.13% |
| All Indica | 2759 | 16.10% | 0.80% | 3.66% | 79.34% | T: 0.18% |
| All Japonica | 1512 | 96.40% | 0.00% | 0.53% | 3.11% | NA |
| Aus | 269 | 3.30% | 0.00% | 1.86% | 94.42% | T: 0.37% |
| Indica I | 595 | 5.20% | 0.20% | 2.52% | 92.10% | NA |
| Indica II | 465 | 12.90% | 3.40% | 2.58% | 80.86% | T: 0.22% |
| Indica III | 913 | 26.50% | 0.10% | 4.27% | 69.00% | T: 0.11% |
| Indica Intermediate | 786 | 14.00% | 0.40% | 4.45% | 80.79% | T: 0.38% |
| Temperate Japonica | 767 | 98.40% | 0.00% | 0.26% | 1.30% | NA |
| Tropical Japonica | 504 | 93.30% | 0.00% | 1.19% | 5.56% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 0.00% | 3.73% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 60.00% | 0.00% | 1.11% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412755385 | G -> DEL | N | N | silent_mutation | Average:7.02; most accessible tissue: Callus, score: 22.586 | N | N | N | N |
| vg0412755385 | G -> GA | LOC_Os04g22510.1 | upstream_gene_variant ; 4720.0bp to feature; MODIFIER | silent_mutation | Average:7.02; most accessible tissue: Callus, score: 22.586 | N | N | N | N |
| vg0412755385 | G -> GA | LOC_Os04g22510-LOC_Os04g22520 | intergenic_region ; MODIFIER | silent_mutation | Average:7.02; most accessible tissue: Callus, score: 22.586 | N | N | N | N |
| vg0412755385 | G -> T | LOC_Os04g22510.1 | upstream_gene_variant ; 4719.0bp to feature; MODIFIER | silent_mutation | Average:7.02; most accessible tissue: Callus, score: 22.586 | N | N | N | N |
| vg0412755385 | G -> T | LOC_Os04g22510-LOC_Os04g22520 | intergenic_region ; MODIFIER | silent_mutation | Average:7.02; most accessible tissue: Callus, score: 22.586 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412755385 | NA | 2.59E-08 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412755385 | NA | 4.03E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412755385 | 1.69E-06 | 1.69E-06 | mr1786 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412755385 | 7.82E-07 | 4.20E-08 | mr1910 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412755385 | NA | 3.98E-06 | mr1955 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |