\
| Variant ID: vg0412735652 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12735652 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCACAACAAACTTGTCCAGAAATTCCATGAACACTTTGTTCATCAGATTCATGAAGAATGCAGGTGCGTTGGTAAGTCCGAAAGACATAACCGTGCACTC[A/C]
TATAGCCCGTACCGGGTGGTGAAGGCCGTCTTTGGAATATCCTCTTCCCGAATCCTCAACTGGTGGTAGCCTGATCGCAGGTCTATCTTAGAAAACACTT
AAGTGTTTTCTAAGATAGACCTGCGATCAGGCTACCACCAGTTGAGGATTCGGGAAGAGGATATTCCAAAGACGGCCTTCACCACCCGGTACGGGCTATA[T/G]
GAGTGCACGGTTATGTCTTTCGGACTTACCAACGCACCTGCATTCTTCATGAATCTGATGAACAAAGTGTTCATGGAATTTCTGGACAAGTTTGTTGTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.60% | 9.40% | 51.86% | 9.10% | NA |
| All Indica | 2759 | 8.30% | 0.50% | 78.72% | 12.40% | NA |
| All Japonica | 1512 | 68.50% | 27.50% | 3.70% | 0.33% | NA |
| Aus | 269 | 4.80% | 0.00% | 65.43% | 29.74% | NA |
| Indica I | 595 | 9.90% | 0.20% | 70.92% | 18.99% | NA |
| Indica II | 465 | 12.30% | 1.30% | 71.83% | 14.62% | NA |
| Indica III | 913 | 5.40% | 0.30% | 87.40% | 6.90% | NA |
| Indica Intermediate | 786 | 8.30% | 0.60% | 78.63% | 12.47% | NA |
| Temperate Japonica | 767 | 94.10% | 2.50% | 2.74% | 0.65% | NA |
| Tropical Japonica | 504 | 30.20% | 65.70% | 4.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.80% | 27.40% | 5.81% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 2.10% | 11.46% | 1.04% | NA |
| Intermediate | 90 | 43.30% | 14.40% | 40.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412735652 | A -> C | LOC_Os04g22490.1 | N | stop_gained | Average:10.391; most accessible tissue: Zhenshan97 flag leaf, score: 17.069 | N | N | N | N |
| vg0412735652 | A -> DEL | LOC_Os04g22490.1 | N | frameshift_variant | Average:10.391; most accessible tissue: Zhenshan97 flag leaf, score: 17.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412735652 | NA | 1.61E-07 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 3.21E-24 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 1.54E-15 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 1.67E-08 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 3.30E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 7.78E-29 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 4.02E-08 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 1.14E-07 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 6.59E-24 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 3.32E-09 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 1.99E-16 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | 7.10E-06 | NA | mr1850_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412735652 | NA | 4.02E-12 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |