\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412723669:

Variant ID: vg0412723669 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12723669
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGGGGGGCATGGCAGTGGGACGGAGGCGGCCTGTGCTGGATCTGGTGGTGTGGTGGTGCTGGCCCCTCGGCTGTGGGGATCTAGCAGGCTGGAGGTGC[G/A]
GCGCGGCAACGACAGCCGGTGTGGAGGAGGTGCGATGGCGTCGGCAGCCAGTAGATCCGTCTCTTCCCCTCCCTCCCTCTTTGTGATTTGTTGATATAGA

Reverse complement sequence

TCTATATCAACAAATCACAAAGAGGGAGGGAGGGGAAGAGACGGATCTACTGGCTGCCGACGCCATCGCACCTCCTCCACACCGGCTGTCGTTGCCGCGC[C/T]
GCACCTCCAGCCTGCTAGATCCCCACAGCCGAGGGGCCAGCACCACCACACCACCAGATCCAGCACAGGCCGCCTCCGTCCCACTGCCATGCCCCCCCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.80% 21.20% 0.00% 0.00% NA
All Indica  2759 74.60% 25.40% 0.00% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 64.10% 35.90% 0.00% 0.00% NA
Indica III  913 65.60% 34.40% 0.00% 0.00% NA
Indica Intermediate  786 75.10% 24.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412723669 G -> A LOC_Os04g22480.1 upstream_gene_variant ; 4106.0bp to feature; MODIFIER silent_mutation Average:58.702; most accessible tissue: Zhenshan97 young leaf, score: 85.886 N N N N
vg0412723669 G -> A LOC_Os04g22470.1 intron_variant ; MODIFIER silent_mutation Average:58.702; most accessible tissue: Zhenshan97 young leaf, score: 85.886 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412723669 NA 4.32E-11 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 1.21E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 1.13E-07 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 8.22E-14 mr1143 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 2.03E-12 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 3.10E-11 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 1.79E-12 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 5.59E-11 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 3.25E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 3.60E-10 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 7.13E-13 mr1969 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 8.27E-13 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 1.02E-06 7.60E-15 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 2.05E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 2.22E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 2.73E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 1.43E-21 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412723669 NA 2.94E-08 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251