\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412697916:

Variant ID: vg0412697916 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12697916
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGAAGGAGTAGGATGCATCTGGTGGTGGTGGAAAGGGTCGCAGCAGCTCTGGCGCACCGAATCGCCAAGGCAAACCTGCTGGTACACCAAAGGGAAAA[G/C]
AGGCAGCTTCCGGGGAGAGCGGCGGCCGTGACATCTCAAAGGTGAAGTGCTTTAACTGTGAAGAATATGGCCATTTTGCTAGGCAATGTCGAAAACCGCG

Reverse complement sequence

CGCGGTTTTCGACATTGCCTAGCAAAATGGCCATATTCTTCACAGTTAAAGCACTTCACCTTTGAGATGTCACGGCCGCCGCTCTCCCCGGAAGCTGCCT[C/G]
TTTTCCCTTTGGTGTACCAGCAGGTTTGCCTTGGCGATTCGGTGCGCCAGAGCTGCTGCGACCCTTTCCACCACCACCAGATGCATCCTACTCCTTCTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 12.30% 0.04% 1.63% NA
All Indica  2759 82.30% 14.90% 0.07% 2.72% NA
All Japonica  1512 99.70% 0.20% 0.00% 0.07% NA
Aus  269 47.60% 52.40% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 50.50% 35.10% 0.00% 14.41% NA
Indica III  913 86.60% 13.10% 0.00% 0.22% NA
Indica Intermediate  786 83.30% 15.60% 0.25% 0.76% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412697916 G -> C LOC_Os04g22410.1 upstream_gene_variant ; 2727.0bp to feature; MODIFIER silent_mutation Average:48.558; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0412697916 G -> C LOC_Os04g22430.1 upstream_gene_variant ; 327.0bp to feature; MODIFIER silent_mutation Average:48.558; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0412697916 G -> C LOC_Os04g22420.1 downstream_gene_variant ; 88.0bp to feature; MODIFIER silent_mutation Average:48.558; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0412697916 G -> C LOC_Os04g22420-LOC_Os04g22430 intergenic_region ; MODIFIER silent_mutation Average:48.558; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0412697916 G -> DEL N N silent_mutation Average:48.558; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412697916 NA 4.78E-09 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 7.66E-06 8.93E-10 mr1062 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 3.17E-11 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 1.32E-10 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 1.36E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 2.18E-10 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 4.43E-10 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 1.87E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 4.08E-11 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 2.23E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 2.21E-08 5.81E-18 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 1.31E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 2.02E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 9.57E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 1.71E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 2.01E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 1.66E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 4.04E-06 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 1.09E-09 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 1.85E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697916 NA 1.99E-09 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251