\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412697867:

Variant ID: vg0412697867 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12697867
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGAAGCAAGTTGTATCTCACGGAGGAACAATGGCAGGCACGGAGCAAGCAGAAGGAGTAGGATGCATCTGGTGGTGGTGGAAAGGGTCGCAGCAGCTC[T/G]
GGCGCACCGAATCGCCAAGGCAAACCTGCTGGTACACCAAAGGGAAAAGAGGCAGCTTCCGGGGAGAGCGGCGGCCGTGACATCTCAAAGGTGAAGTGCT

Reverse complement sequence

AGCACTTCACCTTTGAGATGTCACGGCCGCCGCTCTCCCCGGAAGCTGCCTCTTTTCCCTTTGGTGTACCAGCAGGTTTGCCTTGGCGATTCGGTGCGCC[A/C]
GAGCTGCTGCGACCCTTTCCACCACCACCAGATGCATCCTACTCCTTCTGCTTGCTCCGTGCCTGCCATTGTTCCTCCGTGAGATACAACTTGCTTCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 38.90% 6.86% 5.86% NA
All Indica  2759 69.80% 9.50% 11.09% 9.60% NA
All Japonica  1512 5.80% 94.10% 0.07% 0.07% NA
Aus  269 87.00% 5.60% 4.09% 3.35% NA
Indica I  595 62.90% 12.30% 21.34% 3.53% NA
Indica II  465 59.60% 15.10% 8.39% 16.99% NA
Indica III  913 75.80% 5.10% 7.34% 11.72% NA
Indica Intermediate  786 74.00% 9.30% 9.29% 7.38% NA
Temperate Japonica  767 4.60% 95.40% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.20% 0.00% NA
Japonica Intermediate  241 19.50% 80.10% 0.00% 0.41% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 37.80% 53.30% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412697867 T -> DEL N N silent_mutation Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0412697867 T -> G LOC_Os04g22410.1 upstream_gene_variant ; 2678.0bp to feature; MODIFIER silent_mutation Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0412697867 T -> G LOC_Os04g22430.1 upstream_gene_variant ; 376.0bp to feature; MODIFIER silent_mutation Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0412697867 T -> G LOC_Os04g22420.1 downstream_gene_variant ; 39.0bp to feature; MODIFIER silent_mutation Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0412697867 T -> G LOC_Os04g22420-LOC_Os04g22430 intergenic_region ; MODIFIER silent_mutation Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412697867 NA 1.68E-21 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 4.63E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 7.89E-18 mr1239 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 5.71E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 4.83E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 3.18E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 9.12E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 6.02E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 2.48E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 1.51E-24 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 1.66E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 3.56E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412697867 NA 9.93E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251