\
| Variant ID: vg0412697867 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12697867 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAGAAGCAAGTTGTATCTCACGGAGGAACAATGGCAGGCACGGAGCAAGCAGAAGGAGTAGGATGCATCTGGTGGTGGTGGAAAGGGTCGCAGCAGCTC[T/G]
GGCGCACCGAATCGCCAAGGCAAACCTGCTGGTACACCAAAGGGAAAAGAGGCAGCTTCCGGGGAGAGCGGCGGCCGTGACATCTCAAAGGTGAAGTGCT
AGCACTTCACCTTTGAGATGTCACGGCCGCCGCTCTCCCCGGAAGCTGCCTCTTTTCCCTTTGGTGTACCAGCAGGTTTGCCTTGGCGATTCGGTGCGCC[A/C]
GAGCTGCTGCGACCCTTTCCACCACCACCAGATGCATCCTACTCCTTCTGCTTGCTCCGTGCCTGCCATTGTTCCTCCGTGAGATACAACTTGCTTCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.40% | 38.90% | 6.86% | 5.86% | NA |
| All Indica | 2759 | 69.80% | 9.50% | 11.09% | 9.60% | NA |
| All Japonica | 1512 | 5.80% | 94.10% | 0.07% | 0.07% | NA |
| Aus | 269 | 87.00% | 5.60% | 4.09% | 3.35% | NA |
| Indica I | 595 | 62.90% | 12.30% | 21.34% | 3.53% | NA |
| Indica II | 465 | 59.60% | 15.10% | 8.39% | 16.99% | NA |
| Indica III | 913 | 75.80% | 5.10% | 7.34% | 11.72% | NA |
| Indica Intermediate | 786 | 74.00% | 9.30% | 9.29% | 7.38% | NA |
| Temperate Japonica | 767 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 98.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.50% | 80.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 53.30% | 6.67% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412697867 | T -> DEL | N | N | silent_mutation | Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0412697867 | T -> G | LOC_Os04g22410.1 | upstream_gene_variant ; 2678.0bp to feature; MODIFIER | silent_mutation | Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0412697867 | T -> G | LOC_Os04g22430.1 | upstream_gene_variant ; 376.0bp to feature; MODIFIER | silent_mutation | Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0412697867 | T -> G | LOC_Os04g22420.1 | downstream_gene_variant ; 39.0bp to feature; MODIFIER | silent_mutation | Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0412697867 | T -> G | LOC_Os04g22420-LOC_Os04g22430 | intergenic_region ; MODIFIER | silent_mutation | Average:46.789; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412697867 | NA | 1.68E-21 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 4.63E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 7.89E-18 | mr1239 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 5.71E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 4.83E-21 | mr1254 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 3.18E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 9.12E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 6.02E-12 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 2.48E-11 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 1.51E-24 | mr1903 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 1.66E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 3.56E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412697867 | NA | 9.93E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |