Variant ID: vg0412484073 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 12484073 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 103. )
GTCCGTGCCATCGAGGATGCCTGTGGAGTGGTGTTCCCGCTGTAGTTCAAGTCAAGGCTTAGCTCCAGTTATCTTTTGTTTTTCCGCTGCATTTATGTAA[A/G]
ACTTTTATAATGTTTGTAAGACGTGGATCTGTATGTCAACTTTGTCGTTTGTGTACCCCGGCCGGTCCTGGACGGGGATTTTAATGCACATTCTGCTTGG
CCAAGCAGAATGTGCATTAAAATCCCCGTCCAGGACCGGCCGGGGTACACAAACGACAAAGTTGACATACAGATCCACGTCTTACAAACATTATAAAAGT[T/C]
TTACATAAATGCAGCGGAAAAACAAAAGATAACTGGAGCTAAGCCTTGACTTGAACTACAGCGGGAACACCACTCCACAGGCATCCTCGATGGCACGGAC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 50.60% | 6.30% | 5.40% | 37.75% | NA |
All Indica | 2759 | 24.90% | 9.60% | 8.12% | 57.41% | NA |
All Japonica | 1512 | 99.20% | 0.20% | 0.00% | 0.60% | NA |
Aus | 269 | 21.20% | 8.60% | 9.29% | 60.97% | NA |
Indica I | 595 | 48.10% | 4.90% | 3.87% | 43.19% | NA |
Indica II | 465 | 26.20% | 11.40% | 8.17% | 54.19% | NA |
Indica III | 913 | 6.60% | 12.00% | 10.62% | 70.76% | NA |
Indica Intermediate | 786 | 27.90% | 9.20% | 8.40% | 54.58% | NA |
Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
Tropical Japonica | 504 | 99.00% | 0.20% | 0.00% | 0.79% | NA |
Japonica Intermediate | 241 | 97.90% | 0.80% | 0.00% | 1.24% | NA |
VI/Aromatic | 96 | 92.70% | 0.00% | 2.08% | 5.21% | NA |
Intermediate | 90 | 63.30% | 7.80% | 4.44% | 24.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0412484073 | A -> DEL | N | N | silent_mutation | Average:11.698; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
vg0412484073 | A -> G | LOC_Os04g22040.1 | upstream_gene_variant ; 1773.0bp to feature; MODIFIER | silent_mutation | Average:11.698; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
vg0412484073 | A -> G | LOC_Os04g22030.1 | downstream_gene_variant ; 3124.0bp to feature; MODIFIER | silent_mutation | Average:11.698; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
vg0412484073 | A -> G | LOC_Os04g22050.1 | downstream_gene_variant ; 322.0bp to feature; MODIFIER | silent_mutation | Average:11.698; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
vg0412484073 | A -> G | LOC_Os04g22060.1 | downstream_gene_variant ; 3368.0bp to feature; MODIFIER | silent_mutation | Average:11.698; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
vg0412484073 | A -> G | LOC_Os04g22040-LOC_Os04g22050 | intergenic_region ; MODIFIER | silent_mutation | Average:11.698; most accessible tissue: Zhenshan97 panicle, score: 32.308 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0412484073 | 5.81E-09 | 4.35E-10 | mr1071_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412484073 | 7.99E-06 | NA | mr1080_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412484073 | 1.96E-08 | 2.12E-08 | mr1080_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412484073 | 1.34E-07 | NA | mr1203_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412484073 | 3.82E-06 | NA | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412484073 | 1.41E-07 | 3.52E-09 | mr1613_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0412484073 | 3.39E-06 | NA | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |