Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0412477593:

Variant ID: vg0412477593 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12477593
Reference Allele: A	Alternative Allele: G,C
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAGACCGTGAGGGTCTGAGTCCGACTCTGTTTTCGTCGGGTCTCGGGTTTCCTTGCTCAGGAAGGCATGTTTCGTGTTTCCATTGGTTTCTATCCCGA[A/G,C]
TTGGACGTGAAGGAGGGCCTGTAGAGGGCAAGACCAACCCCTATATAAGGGACAAGGCCGGTTCATTGTAAAACCCCCGAATACAATCTACTTGAATCGT

Reverse complement sequence

ACGATTCAAGTAGATTGTATTCGGGGGTTTTACAATGAACCGGCCTTGTCCCTTATATAGGGGTTGGTCTTGCCCTCTACAGGCCCTCCTTCACGTCCAA[T/C,G]
TCGGGATAGAAACCAATGGAAACACGAAACATGCCTTCCTGAGCAAGGAAACCCGAGACCCGACGAAAACAGAGTCGGACTCAGACCCTCACGGTCTGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.70%	0.50%	19.72%	14.98%	C: 0.04%
All Indica	2759	48.30%	0.80%	28.85%	22.00%	C: 0.04%
All Japonica	1512	99.30%	0.00%	0.33%	0.40%	NA
Aus	269	24.90%	0.00%	43.12%	31.97%	NA
Indica I	595	59.20%	0.70%	23.87%	16.30%	NA
Indica II	465	57.00%	0.40%	20.86%	21.72%	NA
Indica III	913	36.00%	1.20%	37.35%	25.41%	NA
Indica Intermediate	786	49.10%	0.80%	27.48%	22.52%	C: 0.13%
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	99.00%	0.00%	0.20%	0.79%	NA
Japonica Intermediate	241	98.30%	0.00%	1.24%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	72.20%	1.10%	16.67%	8.89%	C: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412477593	A -> C	LOC_Os04g22020.1	downstream_gene_variant ; 3319.0bp to feature; MODIFIER	silent_mutation	Average:50.654; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg0412477593	A -> C	LOC_Os04g22040.1	downstream_gene_variant ; 4444.0bp to feature; MODIFIER	silent_mutation	Average:50.654; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg0412477593	A -> C	LOC_Os04g22030.1	intron_variant ; MODIFIER	silent_mutation	Average:50.654; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg0412477593	A -> DEL	N	N	silent_mutation	Average:50.654; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg0412477593	A -> G	LOC_Os04g22020.1	downstream_gene_variant ; 3319.0bp to feature; MODIFIER	silent_mutation	Average:50.654; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg0412477593	A -> G	LOC_Os04g22040.1	downstream_gene_variant ; 4444.0bp to feature; MODIFIER	silent_mutation	Average:50.654; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N
vg0412477593	A -> G	LOC_Os04g22030.1	intron_variant ; MODIFIER	silent_mutation	Average:50.654; most accessible tissue: Zhenshan97 panicle, score: 87.764	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412477593	NA	1.69E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412477593	NA	2.45E-27	mr1148	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412477593	7.43E-08	NA	mr1071_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412477593	5.05E-07	NA	mr1080_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412477593	7.81E-07	NA	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412477593	7.26E-06	2.34E-07	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412477593	7.99E-06	NA	mr1619_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412477593	4.48E-06	6.29E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251