\
| Variant ID: vg0412456522 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12456522 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATTCCTATATAATAAAGCTTAGTTCCTGAGCATCTGTTTTTCTTCTTTTCTACCCCCCCGTCTGCTCTTCCTCCAGATGGTCTACACCAGGAATGGTAG[C/T]
CGCACAACAGGCGAGGGCAGCAACGGCAAAGAACGCACTGACGGTGTGCATCCCAACAGCGATTCCAGCAATGGTCCGCCACCACTCCCCGAGAATCCGA
TCGGATTCTCGGGGAGTGGTGGCGGACCATTGCTGGAATCGCTGTTGGGATGCACACCGTCAGTGCGTTCTTTGCCGTTGCTGCCCTCGCCTGTTGTGCG[G/A]
CTACCATTCCTGGTGTAGACCATCTGGAGGAAGAGCAGACGGGGGGGTAGAAAAGAAGAAAAACAGATGCTCAGGAACTAAGCTTTATTATATAGGAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 1.70% | 2.52% | 0.00% | NA |
| All Indica | 2759 | 94.00% | 2.40% | 3.59% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.60% | 3.30% | 7.06% | 0.00% | NA |
| Indica I | 595 | 96.50% | 0.30% | 3.19% | 0.00% | NA |
| Indica II | 465 | 96.10% | 1.30% | 2.58% | 0.00% | NA |
| Indica III | 913 | 91.10% | 4.80% | 4.05% | 0.00% | NA |
| Indica Intermediate | 786 | 94.10% | 1.90% | 3.94% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412456522 | C -> T | LOC_Os04g22000.1 | synonymous_variant ; p.Ser316Ser; LOW | synonymous_codon | Average:40.99; most accessible tissue: Minghui63 young leaf, score: 55.178 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412456522 | 2.82E-06 | 7.48E-06 | mr1312 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412456522 | NA | 6.64E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412456522 | 6.21E-06 | 6.21E-06 | mr1463 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412456522 | NA | 6.91E-06 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412456522 | 3.35E-06 | NA | mr1669 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412456522 | 1.44E-06 | 7.23E-07 | mr1669 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412456522 | NA | 5.92E-06 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412456522 | NA | 8.91E-06 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412456522 | NA | 8.28E-14 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412456522 | NA | 2.08E-11 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |