\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412131185:

Variant ID: vg0412131185 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12131185
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGGGAGTTCCATGCGCTTCATTAGGGAAACAAGATAGCTATAGAGTACCTACACGAGTTCAACCGCCTATTATTATTTATTACGACGACAGAATAATC[C/T]
GCAAGCGCACAAATACAGTCGTAGCCTTCACCCCAAGAGTATTCCAGGATATAGTATCCACAGGCAACGTATGTGTATAATCTAAGAACGAGATTCTTCC

Reverse complement sequence

GGAAGAATCTCGTTCTTAGATTATACACATACGTTGCCTGTGGATACTATATCCTGGAATACTCTTGGGGTGAAGGCTACGACTGTATTTGTGCGCTTGC[G/A]
GATTATTCTGTCGTCGTAATAAATAATAATAGGCGGTTGAACTCGTGTAGGTACTCTATAGCTATCTTGTTTCCCTAATGAAGCGCATGGAACTCCCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 17.80% 0.36% 0.68% NA
All Indica  2759 98.40% 0.50% 0.25% 0.87% NA
All Japonica  1512 51.20% 47.90% 0.60% 0.26% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.10% 1.30% 0.00% 0.65% NA
Indica III  913 97.60% 0.20% 0.55% 1.64% NA
Indica Intermediate  786 98.50% 0.50% 0.25% 0.76% NA
Temperate Japonica  767 86.70% 12.40% 0.91% 0.00% NA
Tropical Japonica  504 4.20% 94.80% 0.40% 0.60% NA
Japonica Intermediate  241 36.50% 63.10% 0.00% 0.41% NA
VI/Aromatic  96 15.60% 83.30% 0.00% 1.04% NA
Intermediate  90 71.10% 24.40% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412131185 C -> DEL N N silent_mutation Average:55.887; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0412131185 C -> T LOC_Os04g21450.1 upstream_gene_variant ; 2862.0bp to feature; MODIFIER silent_mutation Average:55.887; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0412131185 C -> T LOC_Os04g21450-LOC_Os04g21460 intergenic_region ; MODIFIER silent_mutation Average:55.887; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412131185 NA 1.43E-11 mr1552 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412131185 NA 6.95E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412131185 NA 2.81E-06 mr1964 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412131185 NA 8.96E-10 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412131185 NA 2.59E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412131185 NA 1.71E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251