\
| Variant ID: vg0412131185 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12131185 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 286. )
AGAGGGAGTTCCATGCGCTTCATTAGGGAAACAAGATAGCTATAGAGTACCTACACGAGTTCAACCGCCTATTATTATTTATTACGACGACAGAATAATC[C/T]
GCAAGCGCACAAATACAGTCGTAGCCTTCACCCCAAGAGTATTCCAGGATATAGTATCCACAGGCAACGTATGTGTATAATCTAAGAACGAGATTCTTCC
GGAAGAATCTCGTTCTTAGATTATACACATACGTTGCCTGTGGATACTATATCCTGGAATACTCTTGGGGTGAAGGCTACGACTGTATTTGTGCGCTTGC[G/A]
GATTATTCTGTCGTCGTAATAAATAATAATAGGCGGTTGAACTCGTGTAGGTACTCTATAGCTATCTTGTTTCCCTAATGAAGCGCATGGAACTCCCTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.20% | 17.80% | 0.36% | 0.68% | NA |
| All Indica | 2759 | 98.40% | 0.50% | 0.25% | 0.87% | NA |
| All Japonica | 1512 | 51.20% | 47.90% | 0.60% | 0.26% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.30% | 0.00% | 0.65% | NA |
| Indica III | 913 | 97.60% | 0.20% | 0.55% | 1.64% | NA |
| Indica Intermediate | 786 | 98.50% | 0.50% | 0.25% | 0.76% | NA |
| Temperate Japonica | 767 | 86.70% | 12.40% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 4.20% | 94.80% | 0.40% | 0.60% | NA |
| Japonica Intermediate | 241 | 36.50% | 63.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 15.60% | 83.30% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 71.10% | 24.40% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412131185 | C -> DEL | N | N | silent_mutation | Average:55.887; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0412131185 | C -> T | LOC_Os04g21450.1 | upstream_gene_variant ; 2862.0bp to feature; MODIFIER | silent_mutation | Average:55.887; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0412131185 | C -> T | LOC_Os04g21450-LOC_Os04g21460 | intergenic_region ; MODIFIER | silent_mutation | Average:55.887; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412131185 | NA | 1.43E-11 | mr1552 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412131185 | NA | 6.95E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412131185 | NA | 2.81E-06 | mr1964 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412131185 | NA | 8.96E-10 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412131185 | NA | 2.59E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412131185 | NA | 1.71E-13 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |