\
| Variant ID: vg0412125261 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12125261 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 85. )
CACCTCCCGCCATTGCTCGTGCATCGCCAGCACCCATCGCCGGTGGTTGCATGTCGCTGCCCGTTGTTGGTATTTCTTAACATTACTATAAATATAATTC[C/T]
CAGCAATTGCGCAGTAATACTTCTAGTATATTATGGTTACAGAGTTCATTCGCAAGCGCACGGATATACCATTGTAGCATTTCAACCGAGAGTATTCCAA
TTGGAATACTCTCGGTTGAAATGCTACAATGGTATATCCGTGCGCTTGCGAATGAACTCTGTAACCATAATATACTAGAAGTATTACTGCGCAATTGCTG[G/A]
GAATTATATTTATAGTAATGTTAAGAAATACCAACAACGGGCAGCGACATGCAACCACCGGCGATGGGTGCTGGCGATGCACGAGCAATGGCGGGAGGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.30% | 25.30% | 5.06% | 19.36% | NA |
| All Indica | 2759 | 78.90% | 10.90% | 8.16% | 2.03% | NA |
| All Japonica | 1512 | 1.80% | 47.60% | 0.40% | 50.26% | NA |
| Aus | 269 | 46.80% | 52.00% | 0.74% | 0.37% | NA |
| Indica I | 595 | 88.40% | 0.80% | 9.58% | 1.18% | NA |
| Indica II | 465 | 66.70% | 24.10% | 6.24% | 3.01% | NA |
| Indica III | 913 | 77.20% | 12.50% | 8.00% | 2.30% | NA |
| Indica Intermediate | 786 | 80.90% | 8.90% | 8.40% | 1.78% | NA |
| Temperate Japonica | 767 | 0.70% | 80.20% | 0.00% | 19.17% | NA |
| Tropical Japonica | 504 | 2.60% | 4.00% | 0.79% | 92.66% | NA |
| Japonica Intermediate | 241 | 3.70% | 34.90% | 0.83% | 60.58% | NA |
| VI/Aromatic | 96 | 7.30% | 13.50% | 0.00% | 79.17% | NA |
| Intermediate | 90 | 42.20% | 26.70% | 6.67% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412125261 | C -> DEL | N | N | silent_mutation | Average:52.686; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| vg0412125261 | C -> T | LOC_Os04g21450.1 | downstream_gene_variant ; 1415.0bp to feature; MODIFIER | silent_mutation | Average:52.686; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| vg0412125261 | C -> T | LOC_Os04g21430-LOC_Os04g21450 | intergenic_region ; MODIFIER | silent_mutation | Average:52.686; most accessible tissue: Minghui63 young leaf, score: 68.07 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412125261 | NA | 7.06E-06 | mr1174 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412125261 | 2.13E-06 | 2.13E-06 | mr1347 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412125261 | NA | 1.04E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412125261 | NA | 1.23E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412125261 | NA | 5.12E-08 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412125261 | NA | 2.37E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |