\
| Variant ID: vg0412011347 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12011347 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )
TATCTTGTTGTTCATCCATGATGTGAGCAACGGATGTATCCGTAGTAGCCTTAGTCACATCATTCAGTATCACCAGTATATTCATCCTCTAAATTATCAT[C/T]
GACGTACTCACCATCAATGTCATCTTCATTACGCCCACCATTGCCTCTAGCATTGAGATAATCAAAATGCCTCACAAGAGCAGCAAGGCTAATGTCAATG
CATTGACATTAGCCTTGCTGCTCTTGTGAGGCATTTTGATTATCTCAATGCTAGAGGCAATGGTGGGCGTAATGAAGATGACATTGATGGTGAGTACGTC[G/A]
ATGATAATTTAGAGGATGAATATACTGGTGATACTGAATGATGTGACTAAGGCTACTACGGATACATCCGTTGCTCACATCATGGATGAACAACAAGATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.30% | 2.90% | 0.78% | 0.00% | NA |
| All Indica | 2759 | 94.10% | 4.70% | 1.20% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.50% | 2.70% | 0.84% | 0.00% | NA |
| Indica II | 465 | 90.50% | 8.00% | 1.51% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 88.20% | 9.30% | 2.54% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412011347 | C -> T | LOC_Os04g21300.1 | upstream_gene_variant ; 2485.0bp to feature; MODIFIER | silent_mutation | Average:47.961; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0412011347 | C -> T | LOC_Os04g21310.1 | downstream_gene_variant ; 4743.0bp to feature; MODIFIER | silent_mutation | Average:47.961; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| vg0412011347 | C -> T | LOC_Os04g21290.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.961; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412011347 | NA | 5.45E-06 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412011347 | NA | 8.93E-06 | mr1622 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412011347 | 1.08E-06 | 1.08E-06 | mr1687 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412011347 | 3.22E-06 | 3.22E-06 | mr1774 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412011347 | 2.53E-06 | 2.53E-06 | mr1777 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |