\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412011347:

Variant ID: vg0412011347 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12011347
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


TATCTTGTTGTTCATCCATGATGTGAGCAACGGATGTATCCGTAGTAGCCTTAGTCACATCATTCAGTATCACCAGTATATTCATCCTCTAAATTATCAT[C/T]
GACGTACTCACCATCAATGTCATCTTCATTACGCCCACCATTGCCTCTAGCATTGAGATAATCAAAATGCCTCACAAGAGCAGCAAGGCTAATGTCAATG

Reverse complement sequence

CATTGACATTAGCCTTGCTGCTCTTGTGAGGCATTTTGATTATCTCAATGCTAGAGGCAATGGTGGGCGTAATGAAGATGACATTGATGGTGAGTACGTC[G/A]
ATGATAATTTAGAGGATGAATATACTGGTGATACTGAATGATGTGACTAAGGCTACTACGGATACATCCGTTGCTCACATCATGGATGAACAACAAGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.30% 2.90% 0.78% 0.00% NA
All Indica  2759 94.10% 4.70% 1.20% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 96.50% 2.70% 0.84% 0.00% NA
Indica II  465 90.50% 8.00% 1.51% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 88.20% 9.30% 2.54% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412011347 C -> T LOC_Os04g21300.1 upstream_gene_variant ; 2485.0bp to feature; MODIFIER silent_mutation Average:47.961; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0412011347 C -> T LOC_Os04g21310.1 downstream_gene_variant ; 4743.0bp to feature; MODIFIER silent_mutation Average:47.961; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0412011347 C -> T LOC_Os04g21290.1 intron_variant ; MODIFIER silent_mutation Average:47.961; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412011347 NA 5.45E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412011347 NA 8.93E-06 mr1622 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412011347 1.08E-06 1.08E-06 mr1687 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412011347 3.22E-06 3.22E-06 mr1774 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412011347 2.53E-06 2.53E-06 mr1777 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251