\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411637990:

Variant ID: vg0411637990 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11637990
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, A: 0.32, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATCAGAATTTATCTTCTCTGTTTAGGTCTCCTAAAAATTCAAACTAATTTCCAAAGGGCCCATTTTCTCCTAATTACTGTGAGTAATCTATCCAAAA[T/A]
TTTTTAAGTGCAACCAAAGAAAATGGAATCTAGGTATCTTCAACTATCATCACAAAAATTCACACTAATTTATCCTGGCCACAAAATAAACTATCGAGTT

Reverse complement sequence

AACTCGATAGTTTATTTTGTGGCCAGGATAAATTAGTGTGAATTTTTGTGATGATAGTTGAAGATACCTAGATTCCATTTTCTTTGGTTGCACTTAAAAA[A/T]
TTTTGGATAGATTACTCACAGTAATTAGGAGAAAATGGGCCCTTTGGAAATTAGTTTGAATTTTTAGGAGACCTAAACAGAGAAGATAAATTCTGATAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 13.40% 1.86% 29.62% NA
All Indica  2759 53.30% 1.70% 2.28% 42.70% NA
All Japonica  1512 52.10% 37.10% 0.60% 10.25% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 26.20% 0.00% 3.70% 70.08% NA
Indica II  465 73.50% 2.20% 1.08% 23.23% NA
Indica III  913 56.30% 2.70% 2.52% 38.44% NA
Indica Intermediate  786 58.30% 1.70% 1.65% 38.42% NA
Temperate Japonica  767 85.80% 7.00% 0.13% 7.04% NA
Tropical Japonica  504 5.00% 86.90% 0.99% 7.14% NA
Japonica Intermediate  241 43.20% 28.60% 1.24% 26.97% NA
VI/Aromatic  96 26.00% 6.20% 14.58% 53.12% NA
Intermediate  90 61.10% 18.90% 2.22% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411637990 T -> DEL N N silent_mutation Average:86.005; most accessible tissue: Callus, score: 94.311 N N N N
vg0411637990 T -> A LOC_Os04g20749.1 upstream_gene_variant ; 385.0bp to feature; MODIFIER silent_mutation Average:86.005; most accessible tissue: Callus, score: 94.311 N N N N
vg0411637990 T -> A LOC_Os04g20749.2 upstream_gene_variant ; 385.0bp to feature; MODIFIER silent_mutation Average:86.005; most accessible tissue: Callus, score: 94.311 N N N N
vg0411637990 T -> A LOC_Os04g20740.1 downstream_gene_variant ; 3260.0bp to feature; MODIFIER silent_mutation Average:86.005; most accessible tissue: Callus, score: 94.311 N N N N
vg0411637990 T -> A LOC_Os04g20740-LOC_Os04g20749 intergenic_region ; MODIFIER silent_mutation Average:86.005; most accessible tissue: Callus, score: 94.311 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411637990 2.74E-08 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 1.89E-06 NA mr1080 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 2.36E-07 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 8.44E-08 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 NA 1.52E-21 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 NA 2.83E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 NA 1.49E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 NA 6.95E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 1.46E-07 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 NA 3.87E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 NA 7.99E-09 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 3.40E-10 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 1.76E-11 NA mr1080_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 2.62E-07 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 2.87E-12 NA mr1203_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 NA 1.27E-21 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 NA 1.08E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 NA 7.04E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 1.35E-10 NA mr1613_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411637990 1.89E-09 NA mr1619_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251