\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411431095:

Variant ID: vg0411431095 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11431095
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.54, C: 0.46, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGTCGTCTCATAATTTAACTTAAATTTTTCATATGGACACGGATTGAGACAAATTTTATATGGAAATTATAGCTCTCGACGAGATCTATAATTTTAT[A/C,T]
GGTGATAACATTTTCATTTGAAATCTTTTAGATATTCAAAACTATGATTCAAATCTCAGTTAGGCACGCTCAAATGGAACGATATGTATTTTTCCAATAG

Reverse complement sequence

CTATTGGAAAAATACATATCGTTCCATTTGAGCGTGCCTAACTGAGATTTGAATCATAGTTTTGAATATCTAAAAGATTTCAAATGAAAATGTTATCACC[T/G,A]
ATAAAATTATAGATCTCGTCGAGAGCTATAATTTCCATATAAAATTTGTCTCAATCCGTGTCCATATGAAAAATTTAAGTTAAATTATGAGACGACAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 36.00% 0.25% 0.00% T: 2.39%
All Indica  2759 92.90% 2.80% 0.33% 0.00% T: 4.06%
All Japonica  1512 1.10% 98.90% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.50% 1.20% 0.17% 0.00% T: 0.17%
Indica II  465 95.50% 3.90% 0.22% 0.00% T: 0.43%
Indica III  913 86.10% 2.80% 0.22% 0.00% T: 10.84%
Indica Intermediate  786 94.90% 3.20% 0.64% 0.00% T: 1.27%
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 85.40% 1.04% 0.00% NA
Intermediate  90 44.40% 52.20% 2.22% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411431095 A -> C LOC_Os04g20424.1 upstream_gene_variant ; 519.0bp to feature; MODIFIER silent_mutation Average:31.591; most accessible tissue: Minghui63 flower, score: 42.913 N N N N
vg0411431095 A -> C LOC_Os04g20430.1 upstream_gene_variant ; 1824.0bp to feature; MODIFIER silent_mutation Average:31.591; most accessible tissue: Minghui63 flower, score: 42.913 N N N N
vg0411431095 A -> C LOC_Os04g20440.1 upstream_gene_variant ; 4949.0bp to feature; MODIFIER silent_mutation Average:31.591; most accessible tissue: Minghui63 flower, score: 42.913 N N N N
vg0411431095 A -> C LOC_Os04g20424-LOC_Os04g20430 intergenic_region ; MODIFIER silent_mutation Average:31.591; most accessible tissue: Minghui63 flower, score: 42.913 N N N N
vg0411431095 A -> T LOC_Os04g20424.1 upstream_gene_variant ; 519.0bp to feature; MODIFIER silent_mutation Average:31.591; most accessible tissue: Minghui63 flower, score: 42.913 N N N N
vg0411431095 A -> T LOC_Os04g20430.1 upstream_gene_variant ; 1824.0bp to feature; MODIFIER silent_mutation Average:31.591; most accessible tissue: Minghui63 flower, score: 42.913 N N N N
vg0411431095 A -> T LOC_Os04g20440.1 upstream_gene_variant ; 4949.0bp to feature; MODIFIER silent_mutation Average:31.591; most accessible tissue: Minghui63 flower, score: 42.913 N N N N
vg0411431095 A -> T LOC_Os04g20424-LOC_Os04g20430 intergenic_region ; MODIFIER silent_mutation Average:31.591; most accessible tissue: Minghui63 flower, score: 42.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411431095 NA 3.64E-07 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 7.64E-07 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 2.16E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 1.39E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 7.97E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 1.11E-10 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 9.30E-53 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 3.46E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 9.08E-06 2.39E-104 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 9.71E-08 6.27E-09 mr1071_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 5.87E-06 3.93E-105 mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 2.56E-07 8.14E-09 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 1.16E-100 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 8.09E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 5.85E-08 4.80E-09 mr1203_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 3.72E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 2.43E-64 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 1.44E-15 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 3.12E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 5.86E-07 2.59E-123 mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 1.91E-09 1.46E-09 mr1613_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 2.27E-100 mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 1.90E-06 9.47E-07 mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 2.04E-30 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411431095 NA 4.33E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251