\
| Variant ID: vg0411404313 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11404313 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.27, others allele: 0.00, population size: 186. )
ATGAGCTTGCGCGTAGGAAGCTTGATCGGGAACAATTCTTTTTCTGCCAGTTGTGCTGACACCTGCCAACCTTCCTTCATGGCGAGACGTAGGAACTCCG[A/G]
TAGGATCAGTCTCGGCCACGTAATCGATACAAAACTCAATGGCTTCCTCGGTCGTGTCACCTTCAATGATGCTCCCCTCTGGTTTTGCTCTGTTCCGAAC
GTTCGGAACAGAGCAAAACCAGAGGGGAGCATCATTGAAGGTGACACGACCGAGGAAGCCATTGAGTTTTGTATCGATTACGTGGCCGAGACTGATCCTA[T/C]
CGGAGTTCCTACGTCTCGCCATGAAGGAAGGTTGGCAGGTGTCAGCACAACTGGCAGAAAAAGAATTGTTCCCGATCAAGCTTCCTACGCGCAAGCTCAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 34.60% | 2.64% | 8.91% | NA |
| All Indica | 2759 | 52.10% | 47.50% | 0.25% | 0.14% | NA |
| All Japonica | 1512 | 64.90% | 0.90% | 7.08% | 27.12% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 47.70% | 51.40% | 0.22% | 0.65% | NA |
| Indica III | 913 | 41.90% | 57.70% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 47.50% | 52.00% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 93.50% | 0.30% | 0.91% | 5.35% | NA |
| Tropical Japonica | 504 | 16.90% | 1.60% | 18.06% | 63.49% | NA |
| Japonica Intermediate | 241 | 74.30% | 1.70% | 3.73% | 20.33% | NA |
| VI/Aromatic | 96 | 80.20% | 13.50% | 3.12% | 3.12% | NA |
| Intermediate | 90 | 53.30% | 33.30% | 8.89% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411404313 | A -> DEL | LOC_Os04g20390.1 | N | frameshift_variant | Average:25.922; most accessible tissue: Minghui63 root, score: 33.152 | N | N | N | N |
| vg0411404313 | A -> G | LOC_Os04g20390.1 | missense_variant ; p.Ile563Thr; MODERATE | nonsynonymous_codon ; I563T | Average:25.922; most accessible tissue: Minghui63 root, score: 33.152 | benign |
1.473 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411404313 | NA | 6.85E-06 | mr1304 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | NA | 3.38E-13 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | NA | 2.17E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | NA | 8.68E-09 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | NA | 3.28E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | NA | 1.27E-07 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | NA | 1.33E-16 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | NA | 1.12E-08 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | 3.25E-08 | 2.89E-26 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | 5.00E-07 | 7.86E-15 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | NA | 1.66E-07 | mr1304_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | NA | 1.59E-07 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | NA | 1.58E-06 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | 9.01E-09 | 1.89E-21 | mr1830_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | 4.64E-08 | 1.23E-16 | mr1830_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | 1.89E-16 | 6.78E-54 | mr1846_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411404313 | 3.29E-14 | 3.66E-33 | mr1846_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |