\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411323496:

Variant ID: vg0411323496 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11323496
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.29, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CAATGATATCACATCACACCAGAATACCGCCATTCGCAAAAGTACGGAAGTACCAAATTCTTAAAATTAAGTTTGCAGGAGATAGAATCACAGAACTTGC[G/A]
TGTAAACACACTAATTTCAGTAATGAAATAAAACCACGTGAAAGCAATTCTAGCTAGTGTGTACAGGTACCATGGCCAATACCTAGTTCCTAAACATAGG

Reverse complement sequence

CCTATGTTTAGGAACTAGGTATTGGCCATGGTACCTGTACACACTAGCTAGAATTGCTTTCACGTGGTTTTATTTCATTACTGAAATTAGTGTGTTTACA[C/T]
GCAAGTTCTGTGATTCTATCTCCTGCAAACTTAATTTTAAGAATTTGGTACTTCCGTACTTTTGCGAATGGCGGTATTCTGGTGTGATGTGATATCATTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 34.80% 0.06% 0.08% NA
All Indica  2759 51.90% 47.80% 0.11% 0.14% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 77.10% 22.90% 0.00% 0.00% NA
Indica II  465 48.40% 51.60% 0.00% 0.00% NA
Indica III  913 41.60% 58.10% 0.11% 0.22% NA
Indica Intermediate  786 46.90% 52.50% 0.25% 0.25% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411323496 G -> DEL N N silent_mutation Average:59.113; most accessible tissue: Callus, score: 77.564 N N N N
vg0411323496 G -> A LOC_Os04g20270.1 intron_variant ; MODIFIER silent_mutation Average:59.113; most accessible tissue: Callus, score: 77.564 N N N N
vg0411323496 G -> A LOC_Os04g20270.2 intron_variant ; MODIFIER silent_mutation Average:59.113; most accessible tissue: Callus, score: 77.564 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411323496 NA 1.74E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 2.04E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 1.40E-07 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 2.35E-06 mr1304 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 9.09E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 3.91E-14 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 1.59E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 2.36E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 3.59E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 2.73E-08 mr1414 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 1.41E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 7.53E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 3.13E-19 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 1.83E-10 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 5.01E-11 2.39E-29 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 7.65E-10 2.66E-17 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 1.60E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 3.35E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 NA 1.85E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 1.73E-06 2.75E-19 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 6.66E-06 6.85E-15 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 2.23E-14 2.76E-52 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411323496 1.75E-12 2.34E-32 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251