\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410956225:

Variant ID: vg0410956225 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10956225
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAATAGAAAATGAGATATCGCCACAATTTTAATTTTTGTGGCAATTTATATAGTACATGGTACTTTTCACTATTTTTTGTTGCCACGATCAACAAATTC[G/A]
TTGCAATAAAAAATTTATCGTCTCATAATTTAACTTAATTTTTTCATATGGACACGGATTAAGACAAATTTAATATGGAAATTATAGCTCTCGACGATAT

Reverse complement sequence

ATATCGTCGAGAGCTATAATTTCCATATTAAATTTGTCTTAATCCGTGTCCATATGAAAAAATTAAGTTAAATTATGAGACGATAAATTTTTTATTGCAA[C/T]
GAATTTGTTGATCGTGGCAACAAAAAATAGTGAAAAGTACCATGTACTATATAAATTGCCACAAAAATTAAAATTGTGGCGATATCTCATTTTCTATTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 2.90% 4.76% 6.73% NA
All Indica  2759 88.90% 4.90% 6.09% 0.18% NA
All Japonica  1512 78.00% 0.00% 3.57% 18.45% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 58.20% 18.20% 23.70% 0.00% NA
Indica II  465 98.30% 0.20% 0.86% 0.65% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 1.50% 2.93% 0.25% NA
Temperate Japonica  767 96.90% 0.00% 0.91% 2.22% NA
Tropical Japonica  504 46.00% 0.00% 8.33% 45.63% NA
Japonica Intermediate  241 84.60% 0.00% 2.07% 13.28% NA
VI/Aromatic  96 71.90% 0.00% 1.04% 27.08% NA
Intermediate  90 87.80% 1.10% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410956225 G -> DEL N N silent_mutation Average:21.72; most accessible tissue: Minghui63 young leaf, score: 27.355 N N N N
vg0410956225 G -> A LOC_Os04g19640-LOC_Os04g19650 intergenic_region ; MODIFIER silent_mutation Average:21.72; most accessible tissue: Minghui63 young leaf, score: 27.355 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410956225 NA 7.84E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 1.51E-06 NA mr1804 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 8.98E-06 1.51E-07 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 NA 7.15E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 9.72E-06 9.71E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 NA 3.62E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 NA 8.17E-06 mr1556_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 NA 6.69E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 NA 1.48E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 NA 4.36E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 NA 6.44E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 3.94E-06 3.94E-06 mr1764_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410956225 NA 2.06E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251