\
| Variant ID: vg0410956225 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10956225 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCAATAGAAAATGAGATATCGCCACAATTTTAATTTTTGTGGCAATTTATATAGTACATGGTACTTTTCACTATTTTTTGTTGCCACGATCAACAAATTC[G/A]
TTGCAATAAAAAATTTATCGTCTCATAATTTAACTTAATTTTTTCATATGGACACGGATTAAGACAAATTTAATATGGAAATTATAGCTCTCGACGATAT
ATATCGTCGAGAGCTATAATTTCCATATTAAATTTGTCTTAATCCGTGTCCATATGAAAAAATTAAGTTAAATTATGAGACGATAAATTTTTTATTGCAA[C/T]
GAATTTGTTGATCGTGGCAACAAAAAATAGTGAAAAGTACCATGTACTATATAAATTGCCACAAAAATTAAAATTGTGGCGATATCTCATTTTCTATTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.70% | 2.90% | 4.76% | 6.73% | NA |
| All Indica | 2759 | 88.90% | 4.90% | 6.09% | 0.18% | NA |
| All Japonica | 1512 | 78.00% | 0.00% | 3.57% | 18.45% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.20% | 18.20% | 23.70% | 0.00% | NA |
| Indica II | 465 | 98.30% | 0.20% | 0.86% | 0.65% | NA |
| Indica III | 913 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 1.50% | 2.93% | 0.25% | NA |
| Temperate Japonica | 767 | 96.90% | 0.00% | 0.91% | 2.22% | NA |
| Tropical Japonica | 504 | 46.00% | 0.00% | 8.33% | 45.63% | NA |
| Japonica Intermediate | 241 | 84.60% | 0.00% | 2.07% | 13.28% | NA |
| VI/Aromatic | 96 | 71.90% | 0.00% | 1.04% | 27.08% | NA |
| Intermediate | 90 | 87.80% | 1.10% | 2.22% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410956225 | G -> DEL | N | N | silent_mutation | Average:21.72; most accessible tissue: Minghui63 young leaf, score: 27.355 | N | N | N | N |
| vg0410956225 | G -> A | LOC_Os04g19640-LOC_Os04g19650 | intergenic_region ; MODIFIER | silent_mutation | Average:21.72; most accessible tissue: Minghui63 young leaf, score: 27.355 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410956225 | NA | 7.84E-06 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | 1.51E-06 | NA | mr1804 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | 8.98E-06 | 1.51E-07 | mr1804 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | NA | 7.15E-06 | mr1184_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | 9.72E-06 | 9.71E-06 | mr1284_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | NA | 3.62E-07 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | NA | 8.17E-06 | mr1556_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | NA | 6.69E-06 | mr1636_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | NA | 1.48E-06 | mr1683_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | NA | 4.36E-06 | mr1759_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | NA | 6.44E-06 | mr1759_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | 3.94E-06 | 3.94E-06 | mr1764_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410956225 | NA | 2.06E-06 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |