\
| Variant ID: vg0410955533 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10955533 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, T: 0.42, others allele: 0.00, population size: 105. )
GACATTTACAAGGACAACAGAAATCTTTTGGCCTGACCTACCGACCCGTGGGCCCTGAAGGCCCACTCCTAGGCTGCTTATTGGGCTTCCTTGAGCAGGG[G/T]
TCACATGTCGCCGAACCGGCTTCGCCACTCAGTGGATCGGCTTCGCTTTCTACTGGCTGAGCTACGCCAACTGCGATCCGGCTTCATTATTCCGTGTTCT
AGAACACGGAATAATGAAGCCGGATCGCAGTTGGCGTAGCTCAGCCAGTAGAAAGCGAAGCCGATCCACTGAGTGGCGAAGCCGGTTCGGCGACATGTGA[C/A]
CCCTGCTCAAGGAAGCCCAATAAGCAGCCTAGGAGTGGGCCTTCAGGGCCCACGGGTCGGTAGGTCAGGCCAAAAGATTTCTGTTGTCCTTGTAAATGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.90% | 34.90% | 0.02% | 0.17% | NA |
| All Indica | 2759 | 51.90% | 47.70% | 0.04% | 0.29% | NA |
| All Japonica | 1512 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.00% | 22.70% | 0.00% | 0.34% | NA |
| Indica II | 465 | 48.60% | 51.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 41.70% | 57.80% | 0.11% | 0.33% | NA |
| Indica Intermediate | 786 | 46.80% | 52.80% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 36.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410955533 | G -> DEL | N | N | silent_mutation | Average:62.724; most accessible tissue: Zhenshan97 young leaf, score: 83.412 | N | N | N | N |
| vg0410955533 | G -> T | LOC_Os04g19640-LOC_Os04g19650 | intergenic_region ; MODIFIER | silent_mutation | Average:62.724; most accessible tissue: Zhenshan97 young leaf, score: 83.412 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410955533 | NA | 1.46E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 4.95E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 2.80E-13 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 5.12E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 1.05E-09 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 5.24E-08 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 4.08E-07 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 8.03E-09 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 4.84E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 7.30E-18 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 1.24E-09 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | 6.81E-12 | 3.05E-30 | mr1846 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | 3.60E-09 | 4.93E-17 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 7.40E-06 | mr1304_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 2.56E-06 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 8.71E-08 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 6.83E-06 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 9.91E-18 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | NA | 2.82E-14 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | 6.28E-10 | 1.14E-47 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410955533 | 1.03E-09 | 7.13E-30 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |