\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410955533:

Variant ID: vg0410955533 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10955533
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, T: 0.42, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GACATTTACAAGGACAACAGAAATCTTTTGGCCTGACCTACCGACCCGTGGGCCCTGAAGGCCCACTCCTAGGCTGCTTATTGGGCTTCCTTGAGCAGGG[G/T]
TCACATGTCGCCGAACCGGCTTCGCCACTCAGTGGATCGGCTTCGCTTTCTACTGGCTGAGCTACGCCAACTGCGATCCGGCTTCATTATTCCGTGTTCT

Reverse complement sequence

AGAACACGGAATAATGAAGCCGGATCGCAGTTGGCGTAGCTCAGCCAGTAGAAAGCGAAGCCGATCCACTGAGTGGCGAAGCCGGTTCGGCGACATGTGA[C/A]
CCCTGCTCAAGGAAGCCCAATAAGCAGCCTAGGAGTGGGCCTTCAGGGCCCACGGGTCGGTAGGTCAGGCCAAAAGATTTCTGTTGTCCTTGTAAATGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 34.90% 0.02% 0.17% NA
All Indica  2759 51.90% 47.70% 0.04% 0.29% NA
All Japonica  1512 99.00% 1.00% 0.00% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 77.00% 22.70% 0.00% 0.34% NA
Indica II  465 48.60% 51.40% 0.00% 0.00% NA
Indica III  913 41.70% 57.80% 0.11% 0.33% NA
Indica Intermediate  786 46.80% 52.80% 0.00% 0.38% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410955533 G -> DEL N N silent_mutation Average:62.724; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N
vg0410955533 G -> T LOC_Os04g19640-LOC_Os04g19650 intergenic_region ; MODIFIER silent_mutation Average:62.724; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410955533 NA 1.46E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 4.95E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 2.80E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 5.12E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 1.05E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 5.24E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 4.08E-07 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 8.03E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 4.84E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 7.30E-18 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 1.24E-09 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 6.81E-12 3.05E-30 mr1846 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 3.60E-09 4.93E-17 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 7.40E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 2.56E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 8.71E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 6.83E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 9.91E-18 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 NA 2.82E-14 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 6.28E-10 1.14E-47 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410955533 1.03E-09 7.13E-30 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251