\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410865996:

Variant ID: vg0410865996 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10865996
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.38, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAATCAGTCAAAGCAGACAACTAAAAGAAATCAAATTAAATTTTAATCGGCTAAAACCATATTTCATCCAAAAGTACATTTAACTGCACATAAGTGAA[T/C]
ATGGTAAATAATTTATTCAAATACTAGATTATTTATCATGAATAAATGTAATTTTTCTAGAATTTTCCTCCTCTGTTTAGGCCTCCTAAAAATTCAATCT

Reverse complement sequence

AGATTGAATTTTTAGGAGGCCTAAACAGAGGAGGAAAATTCTAGAAAAATTACATTTATTCATGATAAATAATCTAGTATTTGAATAAATTATTTACCAT[A/G]
TTCACTTATGTGCAGTTAAATGTACTTTTGGATGAAATATGGTTTTAGCCGATTAAAATTTAATTTGATTTCTTTTAGTTGTCTGCTTTGACTGATTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 20.40% 0.70% 1.21% NA
All Indica  2759 96.40% 0.70% 0.98% 1.85% NA
All Japonica  1512 39.00% 61.00% 0.00% 0.00% NA
Aus  269 95.20% 0.70% 1.86% 2.23% NA
Indica I  595 99.00% 0.20% 0.50% 0.34% NA
Indica II  465 96.80% 1.70% 0.00% 1.51% NA
Indica III  913 94.00% 0.30% 1.97% 3.72% NA
Indica Intermediate  786 97.20% 1.00% 0.76% 1.02% NA
Temperate Japonica  767 4.00% 96.00% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 31.10% 68.90% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410865996 T -> C LOC_Os04g19500.1 upstream_gene_variant ; 4144.0bp to feature; MODIFIER silent_mutation Average:25.219; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg0410865996 T -> C LOC_Os04g19510.1 upstream_gene_variant ; 2523.0bp to feature; MODIFIER silent_mutation Average:25.219; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg0410865996 T -> C LOC_Os04g19500-LOC_Os04g19510 intergenic_region ; MODIFIER silent_mutation Average:25.219; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg0410865996 T -> DEL N N silent_mutation Average:25.219; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410865996 NA 5.46E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 2.05E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 9.91E-08 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 6.75E-08 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 9.42E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 1.83E-07 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 6.49E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 5.28E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 9.70E-13 mr1282 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 4.84E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 3.35E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 4.02E-06 2.31E-15 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 2.24E-11 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 4.70E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 1.55E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 4.09E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 1.75E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 2.68E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 3.80E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 7.32E-12 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410865996 NA 8.32E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251