\
| Variant ID: vg0410727982 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10727982 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )
GTCGATCGAGCATTGACTTTATTTCGTTTTACTCTTCATTGCTGATCTAATGCCAATAACATCAGCTCAGCGGTTAACGATATGTGATTGGCCCTTTGTC[G/A]
AACGGCTATCGTTTATGGATTTAACTTTGTTTTTCTTGTTTTTCTTTCTTGTTGATTGTAGGATCAAATCAACTGGCATGCCTTTGAACCCAAAAGCAAG
CTTGCTTTTGGGTTCAAAGGCATGCCAGTTGATTTGATCCTACAATCAACAAGAAAGAAAAACAAGAAAAACAAAGTTAAATCCATAAACGATAGCCGTT[C/T]
GACAAAGGGCCAATCACATATCGTTAACCGCTGAGCTGATGTTATTGGCATTAGATCAGCAATGAAGAGTAAAACGAAATAAAGTCAATGCTCGATCGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.10% | 17.40% | 2.54% | 0.02% | NA |
| All Indica | 2759 | 90.60% | 5.50% | 3.91% | 0.00% | NA |
| All Japonica | 1512 | 62.00% | 37.60% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.90% | 15.80% | 14.29% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.30% | 0.86% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.40% | 5.30% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 93.30% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 83.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 23.30% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410727982 | G -> DEL | N | N | silent_mutation | Average:38.546; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0410727982 | G -> A | LOC_Os04g19280.1 | upstream_gene_variant ; 209.0bp to feature; MODIFIER | silent_mutation | Average:38.546; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0410727982 | G -> A | LOC_Os04g19290.1 | upstream_gene_variant ; 3346.0bp to feature; MODIFIER | silent_mutation | Average:38.546; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0410727982 | G -> A | LOC_Os04g19270-LOC_Os04g19280 | intergenic_region ; MODIFIER | silent_mutation | Average:38.546; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410727982 | NA | 3.82E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 2.17E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 3.42E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 9.29E-08 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 4.91E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 2.61E-08 | mr1319 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 7.08E-14 | mr1330 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 4.09E-11 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 5.73E-07 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 3.88E-11 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 3.62E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 2.58E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 8.46E-13 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 2.56E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 3.67E-07 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 1.58E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 3.57E-07 | mr1739 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 3.46E-13 | mr1789 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 6.15E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410727982 | NA | 2.12E-09 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |