\
| Variant ID: vg0410045473 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10045473 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )
AAGAAAAAGGATCCAGAAGGATAAGACGTTTGGCTTATACTCCAGTTTAGCTGCCTGTGGGAGTGGAGCTGAAGCCATCGCTAGACCGTTAATTCCGCTG[C/T]
TGTTTTCTTTTCTTTTGTAAGTATGTAATGATGTTATTATGATGGATTTGTATATTAAATTATCAGTTTGTGTACCTCGGCTAATTCCTGGACGAGGGTT
AACCCTCGTCCAGGAATTAGCCGAGGTACACAAACTGATAATTTAATATACAAATCCATCATAATAACATCATTACATACTTACAAAAGAAAAGAAAACA[G/A]
CAGCGGAATTAACGGTCTAGCGATGGCTTCAGCTCCACTCCCACAGGCAGCTAAACTGGAGTATAAGCCAAACGTCTTATCCTTCTGGATCCTTTTTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 11.10% | 0.78% | 2.22% | NA |
| All Indica | 2759 | 99.50% | 0.30% | 0.04% | 0.14% | NA |
| All Japonica | 1512 | 63.20% | 28.40% | 1.92% | 6.48% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.60% | 0.22% | 0.43% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.40% | 0.50% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 96.60% | 2.70% | 0.26% | 0.39% | NA |
| Tropical Japonica | 504 | 8.30% | 69.40% | 5.36% | 16.87% | NA |
| Japonica Intermediate | 241 | 71.80% | 24.10% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 19.80% | 72.90% | 6.25% | 1.04% | NA |
| Intermediate | 90 | 76.70% | 20.00% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410045473 | C -> DEL | N | N | silent_mutation | Average:42.049; most accessible tissue: Minghui63 flag leaf, score: 64.284 | N | N | N | N |
| vg0410045473 | C -> T | LOC_Os04g18170.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.049; most accessible tissue: Minghui63 flag leaf, score: 64.284 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410045473 | 1.36E-06 | NA | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0410045473 | NA | 9.26E-08 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 3.40E-06 | mr1220 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 4.22E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 4.84E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 1.16E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 8.39E-06 | mr1378 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 8.26E-07 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 4.37E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 3.14E-06 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | 5.45E-06 | NA | mr1526 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 4.79E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 8.55E-07 | mr1739 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410045473 | NA | 9.83E-20 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |