\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409861872:

Variant ID: vg0409861872 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9861872
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTGCACATATTGGAGTCTATTGGGTGCGTTCGTGGCAAAAAATCACTCCGTGATTCGCGCGGCGAACTTTTGTCAATTAATGCCAATATTGGCATAT[G/A]
TTTGCACACGTCGGTGCGAAGATTTTAACCGGAATGAAAAAGTTCAAAAAGCACCAAAACATGATTTTTGGACATATTGGAGTGTATTGGTTGCGTTCCT

Reverse complement sequence

AGGAACGCAACCAATACACTCCAATATGTCCAAAAATCATGTTTTGGTGCTTTTTGAACTTTTTCATTCCGGTTAAAATCTTCGCACCGACGTGTGCAAA[C/T]
ATATGCCAATATTGGCATTAATTGACAAAAGTTCGCCGCGCGAATCACGGAGTGATTTTTTGCCACGAACGCACCCAATAGACTCCAATATGTGCAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.20% 0.50% 15.95% 62.40% NA
All Indica  2759 2.10% 0.70% 18.74% 78.43% NA
All Japonica  1512 60.90% 0.00% 0.40% 38.69% NA
Aus  269 1.10% 0.40% 76.95% 21.56% NA
Indica I  595 2.20% 0.30% 4.03% 93.45% NA
Indica II  465 1.90% 0.40% 22.80% 74.84% NA
Indica III  913 1.90% 0.90% 28.59% 68.67% NA
Indica Intermediate  786 2.40% 1.00% 16.03% 80.53% NA
Temperate Japonica  767 96.00% 0.00% 0.00% 4.04% NA
Tropical Japonica  504 4.40% 0.00% 0.79% 94.84% NA
Japonica Intermediate  241 67.60% 0.00% 0.83% 31.54% NA
VI/Aromatic  96 0.00% 0.00% 12.50% 87.50% NA
Intermediate  90 21.10% 1.10% 13.33% 64.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409861872 G -> DEL N N silent_mutation Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0409861872 G -> A LOC_Os04g17930.1 upstream_gene_variant ; 4657.0bp to feature; MODIFIER silent_mutation Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0409861872 G -> A LOC_Os04g17940.1 downstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N
vg0409861872 G -> A LOC_Os04g17930-LOC_Os04g17940 intergenic_region ; MODIFIER silent_mutation Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409861872 NA 1.60E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409861872 NA 5.96E-06 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409861872 8.89E-07 NA mr1392 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409861872 NA 9.19E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409861872 NA 6.06E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251