Variant ID: vg0409861872 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 9861872 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 59. )
TTTTTGCACATATTGGAGTCTATTGGGTGCGTTCGTGGCAAAAAATCACTCCGTGATTCGCGCGGCGAACTTTTGTCAATTAATGCCAATATTGGCATAT[G/A]
TTTGCACACGTCGGTGCGAAGATTTTAACCGGAATGAAAAAGTTCAAAAAGCACCAAAACATGATTTTTGGACATATTGGAGTGTATTGGTTGCGTTCCT
AGGAACGCAACCAATACACTCCAATATGTCCAAAAATCATGTTTTGGTGCTTTTTGAACTTTTTCATTCCGGTTAAAATCTTCGCACCGACGTGTGCAAA[C/T]
ATATGCCAATATTGGCATTAATTGACAAAAGTTCGCCGCGCGAATCACGGAGTGATTTTTTGCCACGAACGCACCCAATAGACTCCAATATGTGCAAAAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 21.20% | 0.50% | 15.95% | 62.40% | NA |
All Indica | 2759 | 2.10% | 0.70% | 18.74% | 78.43% | NA |
All Japonica | 1512 | 60.90% | 0.00% | 0.40% | 38.69% | NA |
Aus | 269 | 1.10% | 0.40% | 76.95% | 21.56% | NA |
Indica I | 595 | 2.20% | 0.30% | 4.03% | 93.45% | NA |
Indica II | 465 | 1.90% | 0.40% | 22.80% | 74.84% | NA |
Indica III | 913 | 1.90% | 0.90% | 28.59% | 68.67% | NA |
Indica Intermediate | 786 | 2.40% | 1.00% | 16.03% | 80.53% | NA |
Temperate Japonica | 767 | 96.00% | 0.00% | 0.00% | 4.04% | NA |
Tropical Japonica | 504 | 4.40% | 0.00% | 0.79% | 94.84% | NA |
Japonica Intermediate | 241 | 67.60% | 0.00% | 0.83% | 31.54% | NA |
VI/Aromatic | 96 | 0.00% | 0.00% | 12.50% | 87.50% | NA |
Intermediate | 90 | 21.10% | 1.10% | 13.33% | 64.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0409861872 | G -> DEL | N | N | silent_mutation | Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
vg0409861872 | G -> A | LOC_Os04g17930.1 | upstream_gene_variant ; 4657.0bp to feature; MODIFIER | silent_mutation | Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
vg0409861872 | G -> A | LOC_Os04g17940.1 | downstream_gene_variant ; 528.0bp to feature; MODIFIER | silent_mutation | Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
vg0409861872 | G -> A | LOC_Os04g17930-LOC_Os04g17940 | intergenic_region ; MODIFIER | silent_mutation | Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0409861872 | NA | 1.60E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409861872 | NA | 5.96E-06 | mr1111 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409861872 | 8.89E-07 | NA | mr1392 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409861872 | NA | 9.19E-10 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0409861872 | NA | 6.06E-37 | mr1719 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |