Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0409861872:

Variant ID: vg0409861872 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 9861872
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTGCACATATTGGAGTCTATTGGGTGCGTTCGTGGCAAAAAATCACTCCGTGATTCGCGCGGCGAACTTTTGTCAATTAATGCCAATATTGGCATAT[G/A]
TTTGCACACGTCGGTGCGAAGATTTTAACCGGAATGAAAAAGTTCAAAAAGCACCAAAACATGATTTTTGGACATATTGGAGTGTATTGGTTGCGTTCCT

Reverse complement sequence

AGGAACGCAACCAATACACTCCAATATGTCCAAAAATCATGTTTTGGTGCTTTTTGAACTTTTTCATTCCGGTTAAAATCTTCGCACCGACGTGTGCAAA[C/T]
ATATGCCAATATTGGCATTAATTGACAAAAGTTCGCCGCGCGAATCACGGAGTGATTTTTTGCCACGAACGCACCCAATAGACTCCAATATGTGCAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.20%	0.50%	15.95%	62.40%	NA
All Indica	2759	2.10%	0.70%	18.74%	78.43%	NA
All Japonica	1512	60.90%	0.00%	0.40%	38.69%	NA
Aus	269	1.10%	0.40%	76.95%	21.56%	NA
Indica I	595	2.20%	0.30%	4.03%	93.45%	NA
Indica II	465	1.90%	0.40%	22.80%	74.84%	NA
Indica III	913	1.90%	0.90%	28.59%	68.67%	NA
Indica Intermediate	786	2.40%	1.00%	16.03%	80.53%	NA
Temperate Japonica	767	96.00%	0.00%	0.00%	4.04%	NA
Tropical Japonica	504	4.40%	0.00%	0.79%	94.84%	NA
Japonica Intermediate	241	67.60%	0.00%	0.83%	31.54%	NA
VI/Aromatic	96	0.00%	0.00%	12.50%	87.50%	NA
Intermediate	90	21.10%	1.10%	13.33%	64.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0409861872	G -> DEL	N	N	silent_mutation	Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N
vg0409861872	G -> A	LOC_Os04g17930.1	upstream_gene_variant ; 4657.0bp to feature; MODIFIER	silent_mutation	Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N
vg0409861872	G -> A	LOC_Os04g17940.1	downstream_gene_variant ; 528.0bp to feature; MODIFIER	silent_mutation	Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N
vg0409861872	G -> A	LOC_Os04g17930-LOC_Os04g17940	intergenic_region ; MODIFIER	silent_mutation	Average:37.031; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0409861872	NA	1.60E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409861872	NA	5.96E-06	mr1111	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409861872	8.89E-07	NA	mr1392	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409861872	NA	9.19E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409861872	NA	6.06E-37	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251