Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409509076:

Variant ID: vg0409509076 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 9509076
Reference Allele: G	Alternative Allele: A,C
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.04, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGAAGTACTTACATGGTCGCTACCTGCAGCCGATGGAGTATGCTCACTTGATTCAGGAAACGGAGTTGGAGAACGACGAGGCTGAAAAAGACAAATCT[G/A,C]
GGTTAGCATCGGTTATTTAAAGAGATAAAAGATTAAAAAAAATGAAGAAGTATGAGGTTTATCCAGTGGAGTTGGTGCTTTTGGTTTATTGGAAGCCAGC

Reverse complement sequence

GCTGGCTTCCAATAAACCAAAAGCACCAACTCCACTGGATAAACCTCATACTTCTTCATTTTTTTTAATCTTTTATCTCTTTAAATAACCGATGCTAACC[C/T,G]
AGATTTGTCTTTTTCAGCCTCGTCGTTCTCCAACTCCGTTTCCTGAATCAAGTGAGCATACTCCATCGGCTGCAGGTAGCGACCATGTAAGTACTTCTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	23.50%	0.53%	9.75%	C: 0.40%
All Indica	2759	99.10%	0.80%	0.14%	0.00%	NA
All Japonica	1512	2.30%	69.30%	1.12%	25.99%	C: 1.26%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	98.10%	1.50%	0.43%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	98.90%	1.00%	0.13%	0.00%	NA
Temperate Japonica	767	0.40%	97.90%	0.13%	1.56%	NA
Tropical Japonica	504	4.20%	23.00%	2.98%	67.66%	C: 2.18%
Japonica Intermediate	241	4.60%	75.10%	0.41%	16.60%	C: 3.32%
VI/Aromatic	96	21.90%	12.50%	1.04%	64.58%	NA
Intermediate	90	55.60%	34.40%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0409509076	G -> C	LOC_Os04g17360.1	upstream_gene_variant ; 17.0bp to feature; MODIFIER	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0409509076	G -> C	LOC_Os04g17370.1	upstream_gene_variant ; 2415.0bp to feature; MODIFIER	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0409509076	G -> C	LOC_Os04g17340.1	downstream_gene_variant ; 4433.0bp to feature; MODIFIER	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0409509076	G -> C	LOC_Os04g17350.1	downstream_gene_variant ; 1959.0bp to feature; MODIFIER	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0409509076	G -> C	LOC_Os04g17360-LOC_Os04g17370	intergenic_region ; MODIFIER	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0409509076	G -> DEL	N	N	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0409509076	G -> A	LOC_Os04g17360.1	upstream_gene_variant ; 17.0bp to feature; MODIFIER	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0409509076	G -> A	LOC_Os04g17370.1	upstream_gene_variant ; 2415.0bp to feature; MODIFIER	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0409509076	G -> A	LOC_Os04g17340.1	downstream_gene_variant ; 4433.0bp to feature; MODIFIER	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0409509076	G -> A	LOC_Os04g17350.1	downstream_gene_variant ; 1959.0bp to feature; MODIFIER	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N
vg0409509076	G -> A	LOC_Os04g17360-LOC_Os04g17370	intergenic_region ; MODIFIER	silent_mutation	Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0409509076	NA	1.08E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	9.56E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	1.92E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	1.42E-26	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	1.69E-28	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	7.11E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	1.09E-41	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	3.36E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	7.89E-29	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	3.58E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	2.25E-08	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	2.80E-06	mr1220	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	1.53E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	3.96E-53	mr1241	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	1.50E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	5.99E-10	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	4.80E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	1.91E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	5.54E-06	mr1378	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	2.91E-06	NA	mr1403	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	2.56E-09	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	8.74E-33	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	5.32E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	6.11E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	1.77E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	4.93E-10	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	7.34E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	8.51E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	1.03E-31	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	3.18E-13	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	5.64E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	2.82E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	7.54E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	1.74E-11	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076	NA	2.98E-11	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251