\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0409509076:

Variant ID: vg0409509076 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 9509076
Reference Allele: GAlternative Allele: A,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.04, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGAAGTACTTACATGGTCGCTACCTGCAGCCGATGGAGTATGCTCACTTGATTCAGGAAACGGAGTTGGAGAACGACGAGGCTGAAAAAGACAAATCT[G/A,C]
GGTTAGCATCGGTTATTTAAAGAGATAAAAGATTAAAAAAAATGAAGAAGTATGAGGTTTATCCAGTGGAGTTGGTGCTTTTGGTTTATTGGAAGCCAGC

Reverse complement sequence

GCTGGCTTCCAATAAACCAAAAGCACCAACTCCACTGGATAAACCTCATACTTCTTCATTTTTTTTAATCTTTTATCTCTTTAAATAACCGATGCTAACC[C/T,G]
AGATTTGTCTTTTTCAGCCTCGTCGTTCTCCAACTCCGTTTCCTGAATCAAGTGAGCATACTCCATCGGCTGCAGGTAGCGACCATGTAAGTACTTCTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 23.50% 0.53% 9.75% C: 0.40%
All Indica  2759 99.10% 0.80% 0.14% 0.00% NA
All Japonica  1512 2.30% 69.30% 1.12% 25.99% C: 1.26%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 98.10% 1.50% 0.43% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 98.90% 1.00% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 97.90% 0.13% 1.56% NA
Tropical Japonica  504 4.20% 23.00% 2.98% 67.66% C: 2.18%
Japonica Intermediate  241 4.60% 75.10% 0.41% 16.60% C: 3.32%
VI/Aromatic  96 21.90% 12.50% 1.04% 64.58% NA
Intermediate  90 55.60% 34.40% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0409509076 G -> C LOC_Os04g17360.1 upstream_gene_variant ; 17.0bp to feature; MODIFIER silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0409509076 G -> C LOC_Os04g17370.1 upstream_gene_variant ; 2415.0bp to feature; MODIFIER silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0409509076 G -> C LOC_Os04g17340.1 downstream_gene_variant ; 4433.0bp to feature; MODIFIER silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0409509076 G -> C LOC_Os04g17350.1 downstream_gene_variant ; 1959.0bp to feature; MODIFIER silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0409509076 G -> C LOC_Os04g17360-LOC_Os04g17370 intergenic_region ; MODIFIER silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0409509076 G -> DEL N N silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0409509076 G -> A LOC_Os04g17360.1 upstream_gene_variant ; 17.0bp to feature; MODIFIER silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0409509076 G -> A LOC_Os04g17370.1 upstream_gene_variant ; 2415.0bp to feature; MODIFIER silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0409509076 G -> A LOC_Os04g17340.1 downstream_gene_variant ; 4433.0bp to feature; MODIFIER silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0409509076 G -> A LOC_Os04g17350.1 downstream_gene_variant ; 1959.0bp to feature; MODIFIER silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0409509076 G -> A LOC_Os04g17360-LOC_Os04g17370 intergenic_region ; MODIFIER silent_mutation Average:42.904; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0409509076 NA 1.08E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 9.56E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 1.92E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 1.42E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 1.69E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 7.11E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 1.09E-41 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 3.36E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 7.89E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 3.58E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 2.25E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 2.80E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 1.53E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 3.96E-53 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 1.50E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 5.99E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 4.80E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 1.91E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 5.54E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 2.91E-06 NA mr1403 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 2.56E-09 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 8.74E-33 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 5.32E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 6.11E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 1.77E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 4.93E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 7.34E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 8.51E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 1.03E-31 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 3.18E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 5.64E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 2.82E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 7.54E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 1.74E-11 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0409509076 NA 2.98E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251