\
| Variant ID: vg0409436808 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 9436808 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.38, others allele: 0.00, population size: 111. )
CGGCATACATCAAGGGAGGAACATTCAGGTTTCCTATGAATTTTATCACTCGATGAGCTCTGCCAGACCACTTGGGATGGGTCAACTACCAATCGGCTTG[C/T]
TCTTTGCTGATAAAATTCAATGCCGAGGAGAAATCTCATCAACCTTGATGATGGATCGGCTGCTGAATATCCAAGGACCTCCTTTGGGCAGCATTGAAAA
TTTTCAATGCTGCCCAAAGGAGGTCCTTGGATATTCAGCAGCCGATCCATCATCAAGGTTGATGAGATTTCTCCTCGGCATTGAATTTTATCAGCAAAGA[G/A]
CAAGCCGATTGGTAGTTGACCCATCCCAAGTGGTCTGGCAGAGCTCATCGAGTGATAAAATTCATAGGAAACCTGAATGTTCCTCCCTTGATGTATGCCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.80% | 20.20% | 0.93% | 13.14% | NA |
| All Indica | 2759 | 99.10% | 0.50% | 0.07% | 0.40% | NA |
| All Japonica | 1512 | 2.20% | 60.90% | 2.78% | 34.13% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.10% | 0.22% | 1.08% | NA |
| Indica III | 913 | 99.60% | 0.20% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 98.90% | 0.50% | 0.13% | 0.51% | NA |
| Temperate Japonica | 767 | 0.50% | 95.80% | 0.00% | 3.65% | NA |
| Tropical Japonica | 504 | 3.60% | 4.40% | 7.54% | 84.52% | NA |
| Japonica Intermediate | 241 | 4.60% | 68.00% | 1.66% | 25.73% | NA |
| VI/Aromatic | 96 | 21.90% | 0.00% | 0.00% | 78.12% | NA |
| Intermediate | 90 | 58.90% | 20.00% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0409436808 | C -> DEL | LOC_Os04g17210.1 | N | frameshift_variant | Average:68.383; most accessible tissue: Minghui63 flag leaf, score: 88.574 | N | N | N | N |
| vg0409436808 | C -> T | LOC_Os04g17210.1 | missense_variant ; p.Leu290Phe; MODERATE | nonsynonymous_codon ; L290F | Average:68.383; most accessible tissue: Minghui63 flag leaf, score: 88.574 | benign |
-0.355 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0409436808 | NA | 1.27E-07 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 1.23E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 8.15E-11 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 3.45E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 1.03E-09 | mr1251 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 4.62E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | 8.86E-06 | NA | mr1550 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 1.91E-20 | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 5.50E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 4.48E-08 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 8.63E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 3.27E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 2.12E-29 | mr1789 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 3.20E-08 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0409436808 | NA | 2.39E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |