\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408431062:

Variant ID: vg0408431062 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8431062
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCTGAGTTGTGGCAGATACATTACAACATTTGATCAAGGTAACAGTTGATGAGTTAATTAGTCAGAAAACCCAGCTCGGGGGGCAGATTGAAGAACAA[T/C]
AACAGCATCAGCTTGGGGGGCAGGCACATCAATGTCAGCATGATGAGCTATATCAACAGTATCAGCCAGAAGAATCTCAAAGATATTAGAATATAGAAGA

Reverse complement sequence

TCTTCTATATTCTAATATCTTTGAGATTCTTCTGGCTGATACTGTTGATATAGCTCATCATGCTGACATTGATGTGCCTGCCCCCCAAGCTGATGCTGTT[A/G]
TTGTTCTTCAATCTGCCCCCCGAGCTGGGTTTTCTGACTAATTAACTCATCAACTGTTACCTTGATCAAATGTTGTAATGTATCTGCCACAACTCAGATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.30% 11.60% 5.06% 58.02% NA
All Indica  2759 3.70% 0.60% 8.34% 87.39% NA
All Japonica  1512 65.00% 33.60% 0.13% 1.26% NA
Aus  269 0.70% 0.00% 1.12% 98.14% NA
Indica I  595 3.90% 0.00% 5.55% 90.59% NA
Indica II  465 4.70% 1.30% 23.44% 70.54% NA
Indica III  913 1.00% 0.30% 4.16% 94.52% NA
Indica Intermediate  786 6.10% 0.90% 6.36% 86.64% NA
Temperate Japonica  767 96.60% 2.90% 0.00% 0.52% NA
Tropical Japonica  504 13.30% 84.30% 0.00% 2.38% NA
Japonica Intermediate  241 72.60% 25.30% 0.83% 1.24% NA
VI/Aromatic  96 79.20% 6.20% 0.00% 14.58% NA
Intermediate  90 36.70% 21.10% 4.44% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408431062 T -> C LOC_Os04g15000.1 upstream_gene_variant ; 3659.0bp to feature; MODIFIER silent_mutation Average:13.638; most accessible tissue: Callus, score: 36.045 N N N N
vg0408431062 T -> C LOC_Os04g15510.1 upstream_gene_variant ; 2226.0bp to feature; MODIFIER silent_mutation Average:13.638; most accessible tissue: Callus, score: 36.045 N N N N
vg0408431062 T -> C LOC_Os04g15000-LOC_Os04g15510 intergenic_region ; MODIFIER silent_mutation Average:13.638; most accessible tissue: Callus, score: 36.045 N N N N
vg0408431062 T -> DEL N N silent_mutation Average:13.638; most accessible tissue: Callus, score: 36.045 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408431062 NA 1.56E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 6.86E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 3.90E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 3.58E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 2.83E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 1.26E-10 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 2.58E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 4.21E-06 NA mr1726 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 5.71E-08 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 5.44E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 1.95E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 2.86E-09 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 5.69E-19 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 1.72E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 1.07E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408431062 NA 5.70E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251