\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408411178:

Variant ID: vg0408411178 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8411178
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAACAGGGTATTTAGATAAACACCTATGTTCATAAACATATAACATCAGTGGTCTATAGGACCATTACATAATTGTTTGTACAACTGATGAACTGTTT[C/T]
GACTAAATTACATAAAACATAGGGACTAAAGTGAAATTACTGCTGAAAATAAAAAATAAAAACTAAATTTAAGGGGTAAATGGGTGGTGGGCCGAAATCA

Reverse complement sequence

TGATTTCGGCCCACCACCCATTTACCCCTTAAATTTAGTTTTTATTTTTTATTTTCAGCAGTAATTTCACTTTAGTCCCTATGTTTTATGTAATTTAGTC[G/A]
AAACAGTTCATCAGTTGTACAAACAATTATGTAATGGTCCTATAGACCACTGATGTTATATGTTTATGAACATAGGTGTTTATCTAAATACCCTGTTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 1.50% 4.15% 34.11% NA
All Indica  2759 45.80% 1.50% 4.28% 48.39% NA
All Japonica  1512 91.60% 1.70% 3.84% 2.91% NA
Aus  269 18.60% 0.00% 3.35% 78.07% NA
Indica I  595 17.80% 0.00% 1.18% 81.01% NA
Indica II  465 31.40% 7.50% 12.69% 48.39% NA
Indica III  913 75.70% 0.10% 2.63% 21.58% NA
Indica Intermediate  786 41.00% 0.60% 3.56% 54.83% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 79.00% 4.20% 10.52% 6.35% NA
Japonica Intermediate  241 92.50% 1.70% 2.07% 3.73% NA
VI/Aromatic  96 90.60% 3.10% 4.17% 2.08% NA
Intermediate  90 65.60% 3.30% 7.78% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408411178 C -> DEL N N silent_mutation Average:30.03; most accessible tissue: Callus, score: 50.529 N N N N
vg0408411178 C -> T LOC_Os04g14960.1 upstream_gene_variant ; 2216.0bp to feature; MODIFIER silent_mutation Average:30.03; most accessible tissue: Callus, score: 50.529 N N N N
vg0408411178 C -> T LOC_Os04g14980.1 downstream_gene_variant ; 4825.0bp to feature; MODIFIER silent_mutation Average:30.03; most accessible tissue: Callus, score: 50.529 N N N N
vg0408411178 C -> T LOC_Os04g14970.1 intron_variant ; MODIFIER silent_mutation Average:30.03; most accessible tissue: Callus, score: 50.529 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408411178 NA 5.24E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 1.31E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 3.67E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 5.68E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 1.75E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 6.10E-06 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 2.62E-07 3.48E-15 mr1022_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 8.28E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 1.61E-10 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 6.97E-14 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 3.57E-06 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 3.10E-13 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 7.76E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 1.19E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 4.26E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 8.39E-14 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 1.39E-06 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 1.84E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 NA 2.85E-13 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408411178 3.91E-06 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251