\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408393308:

Variant ID: vg0408393308 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8393308
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTACAGGGAGAAGACGCCCTTGTGGTGAAGACAGCAGCCAGATCATCGGGGAGTTTCATCAGGATTGGCGGATAGGCCCCATCGTCTTGATTGGGTCGT[T/G]
TTGAAGTAGATTGGATCTCGTCCGAGTGGTTTGGAGCCAACTCAGTAGAGATGATCTTGGGGTAGATCTCGGTCGAGTTCGGGATACCGAACGGAGCGGA

Reverse complement sequence

TCCGCTCCGTTCGGTATCCCGAACTCGACCGAGATCTACCCCAAGATCATCTCTACTGAGTTGGCTCCAAACCACTCGGACGAGATCCAATCTACTTCAA[A/C]
ACGACCCAATCAAGACGATGGGGCCTATCCGCCAATCCTGATGAAACTCCCCGATGATCTGGCTGCTGTCTTCACCACAAGGGCGTCTTCTCCCTGTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 28.60% 3.45% 0.70% NA
All Indica  2759 87.30% 9.10% 3.44% 0.22% NA
All Japonica  1512 24.90% 69.80% 3.44% 1.79% NA
Aus  269 97.00% 2.20% 0.74% 0.00% NA
Indica I  595 93.90% 4.90% 1.18% 0.00% NA
Indica II  465 90.80% 7.10% 1.29% 0.86% NA
Indica III  913 81.80% 12.00% 6.02% 0.11% NA
Indica Intermediate  786 86.50% 9.90% 3.44% 0.13% NA
Temperate Japonica  767 3.10% 95.80% 0.52% 0.52% NA
Tropical Japonica  504 59.10% 33.90% 5.56% 1.39% NA
Japonica Intermediate  241 22.80% 62.20% 8.30% 6.64% NA
VI/Aromatic  96 81.20% 9.40% 9.38% 0.00% NA
Intermediate  90 60.00% 34.40% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408393308 T -> DEL LOC_Os04g14920.1 N frameshift_variant Average:15.187; most accessible tissue: Callus, score: 24.61 N N N N
vg0408393308 T -> G LOC_Os04g14920.1 missense_variant ; p.Lys82Thr; MODERATE nonsynonymous_codon ; K82T Average:15.187; most accessible tissue: Callus, score: 24.61 benign -0.56 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408393308 NA 2.95E-07 mr1157 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408393308 NA 3.52E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408393308 NA 2.31E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408393308 NA 3.93E-07 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408393308 NA 8.35E-07 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408393308 NA 4.38E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408393308 NA 9.07E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408393308 NA 7.87E-11 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408393308 NA 2.33E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408393308 NA 4.24E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408393308 NA 7.42E-08 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251