\
| Variant ID: vg0408367382 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 8367382 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 84. )
AACATTGCGATTATGATAACGGCGCAACCCTTGCAAGTACCGAGCCGACTGAATTAAAGCTGCTTCGCAGGCTTCTTCCAGTCGATTAAGATCACCTACT[T/C]
GGTTGTCTCTGTAGCGCTCCTCGTTGAAGTTACGAAAACGTAAAGATTCAAATTCCACCTCACAGGGCAACATTGCTTCCGCTCCATACACTAGAAAAAA
TTTTTTCTAGTGTATGGAGCGGAAGCAATGTTGCCCTGTGAGGTGGAATTTGAATCTTTACGTTTTCGTAACTTCAACGAGGAGCGCTACAGAGACAACC[A/G]
AGTAGGTGATCTTAATCGACTGGAAGAAGCCTGCGAAGCAGCTTTAATTCAGTCGGCTCGGTACTTGCAAGGGTTGCGCCGTTATCATAATCGCAATGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.50% | 4.70% | 7.70% | 62.17% | NA |
| All Indica | 2759 | 8.40% | 6.40% | 5.29% | 79.96% | NA |
| All Japonica | 1512 | 62.40% | 1.80% | 10.05% | 25.79% | NA |
| Aus | 269 | 3.00% | 0.40% | 2.23% | 94.42% | NA |
| Indica I | 595 | 18.00% | 0.80% | 2.02% | 79.16% | NA |
| Indica II | 465 | 6.90% | 4.70% | 3.44% | 84.95% | NA |
| Indica III | 913 | 0.80% | 11.70% | 7.67% | 79.85% | NA |
| Indica Intermediate | 786 | 10.80% | 5.30% | 6.11% | 77.74% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.52% | 3.52% | NA |
| Tropical Japonica | 504 | 10.10% | 2.80% | 23.61% | 63.49% | NA |
| Japonica Intermediate | 241 | 64.70% | 5.40% | 12.03% | 17.84% | NA |
| VI/Aromatic | 96 | 0.00% | 11.50% | 51.04% | 37.50% | NA |
| Intermediate | 90 | 23.30% | 6.70% | 12.22% | 57.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0408367382 | T -> C | LOC_Os04g14880.1 | upstream_gene_variant ; 188.0bp to feature; MODIFIER | silent_mutation | Average:8.997; most accessible tissue: Callus, score: 19.629 | N | N | N | N |
| vg0408367382 | T -> C | LOC_Os04g14870.1 | downstream_gene_variant ; 639.0bp to feature; MODIFIER | silent_mutation | Average:8.997; most accessible tissue: Callus, score: 19.629 | N | N | N | N |
| vg0408367382 | T -> C | LOC_Os04g14870-LOC_Os04g14880 | intergenic_region ; MODIFIER | silent_mutation | Average:8.997; most accessible tissue: Callus, score: 19.629 | N | N | N | N |
| vg0408367382 | T -> DEL | N | N | silent_mutation | Average:8.997; most accessible tissue: Callus, score: 19.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0408367382 | NA | 3.63E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408367382 | 9.77E-07 | NA | mr1065 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408367382 | 4.67E-06 | NA | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408367382 | 2.15E-06 | NA | mr1091 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408367382 | 4.53E-06 | NA | mr1094 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408367382 | 2.03E-06 | NA | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408367382 | 4.05E-06 | NA | mr1112 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408367382 | 9.24E-06 | NA | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0408367382 | NA | 3.51E-21 | mr1689 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |