\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408367382:

Variant ID: vg0408367382 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8367382
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AACATTGCGATTATGATAACGGCGCAACCCTTGCAAGTACCGAGCCGACTGAATTAAAGCTGCTTCGCAGGCTTCTTCCAGTCGATTAAGATCACCTACT[T/C]
GGTTGTCTCTGTAGCGCTCCTCGTTGAAGTTACGAAAACGTAAAGATTCAAATTCCACCTCACAGGGCAACATTGCTTCCGCTCCATACACTAGAAAAAA

Reverse complement sequence

TTTTTTCTAGTGTATGGAGCGGAAGCAATGTTGCCCTGTGAGGTGGAATTTGAATCTTTACGTTTTCGTAACTTCAACGAGGAGCGCTACAGAGACAACC[A/G]
AGTAGGTGATCTTAATCGACTGGAAGAAGCCTGCGAAGCAGCTTTAATTCAGTCGGCTCGGTACTTGCAAGGGTTGCGCCGTTATCATAATCGCAATGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.50% 4.70% 7.70% 62.17% NA
All Indica  2759 8.40% 6.40% 5.29% 79.96% NA
All Japonica  1512 62.40% 1.80% 10.05% 25.79% NA
Aus  269 3.00% 0.40% 2.23% 94.42% NA
Indica I  595 18.00% 0.80% 2.02% 79.16% NA
Indica II  465 6.90% 4.70% 3.44% 84.95% NA
Indica III  913 0.80% 11.70% 7.67% 79.85% NA
Indica Intermediate  786 10.80% 5.30% 6.11% 77.74% NA
Temperate Japonica  767 96.00% 0.00% 0.52% 3.52% NA
Tropical Japonica  504 10.10% 2.80% 23.61% 63.49% NA
Japonica Intermediate  241 64.70% 5.40% 12.03% 17.84% NA
VI/Aromatic  96 0.00% 11.50% 51.04% 37.50% NA
Intermediate  90 23.30% 6.70% 12.22% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408367382 T -> C LOC_Os04g14880.1 upstream_gene_variant ; 188.0bp to feature; MODIFIER silent_mutation Average:8.997; most accessible tissue: Callus, score: 19.629 N N N N
vg0408367382 T -> C LOC_Os04g14870.1 downstream_gene_variant ; 639.0bp to feature; MODIFIER silent_mutation Average:8.997; most accessible tissue: Callus, score: 19.629 N N N N
vg0408367382 T -> C LOC_Os04g14870-LOC_Os04g14880 intergenic_region ; MODIFIER silent_mutation Average:8.997; most accessible tissue: Callus, score: 19.629 N N N N
vg0408367382 T -> DEL N N silent_mutation Average:8.997; most accessible tissue: Callus, score: 19.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408367382 NA 3.63E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382 9.77E-07 NA mr1065 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382 4.67E-06 NA mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382 2.15E-06 NA mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382 4.53E-06 NA mr1094 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382 2.03E-06 NA mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382 4.05E-06 NA mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382 9.24E-06 NA mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382 NA 3.51E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251