Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0408367382:

Variant ID: vg0408367382 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8367382
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.37, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

AACATTGCGATTATGATAACGGCGCAACCCTTGCAAGTACCGAGCCGACTGAATTAAAGCTGCTTCGCAGGCTTCTTCCAGTCGATTAAGATCACCTACT[T/C]
GGTTGTCTCTGTAGCGCTCCTCGTTGAAGTTACGAAAACGTAAAGATTCAAATTCCACCTCACAGGGCAACATTGCTTCCGCTCCATACACTAGAAAAAA

Reverse complement sequence

TTTTTTCTAGTGTATGGAGCGGAAGCAATGTTGCCCTGTGAGGTGGAATTTGAATCTTTACGTTTTCGTAACTTCAACGAGGAGCGCTACAGAGACAACC[A/G]
AGTAGGTGATCTTAATCGACTGGAAGAAGCCTGCGAAGCAGCTTTAATTCAGTCGGCTCGGTACTTGCAAGGGTTGCGCCGTTATCATAATCGCAATGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.50%	4.70%	7.70%	62.17%	NA
All Indica	2759	8.40%	6.40%	5.29%	79.96%	NA
All Japonica	1512	62.40%	1.80%	10.05%	25.79%	NA
Aus	269	3.00%	0.40%	2.23%	94.42%	NA
Indica I	595	18.00%	0.80%	2.02%	79.16%	NA
Indica II	465	6.90%	4.70%	3.44%	84.95%	NA
Indica III	913	0.80%	11.70%	7.67%	79.85%	NA
Indica Intermediate	786	10.80%	5.30%	6.11%	77.74%	NA
Temperate Japonica	767	96.00%	0.00%	0.52%	3.52%	NA
Tropical Japonica	504	10.10%	2.80%	23.61%	63.49%	NA
Japonica Intermediate	241	64.70%	5.40%	12.03%	17.84%	NA
VI/Aromatic	96	0.00%	11.50%	51.04%	37.50%	NA
Intermediate	90	23.30%	6.70%	12.22%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408367382	T -> C	LOC_Os04g14880.1	upstream_gene_variant ; 188.0bp to feature; MODIFIER	silent_mutation	Average:8.997; most accessible tissue: Callus, score: 19.629	N	N	N	N
vg0408367382	T -> C	LOC_Os04g14870.1	downstream_gene_variant ; 639.0bp to feature; MODIFIER	silent_mutation	Average:8.997; most accessible tissue: Callus, score: 19.629	N	N	N	N
vg0408367382	T -> C	LOC_Os04g14870-LOC_Os04g14880	intergenic_region ; MODIFIER	silent_mutation	Average:8.997; most accessible tissue: Callus, score: 19.629	N	N	N	N
vg0408367382	T -> DEL	N	N	silent_mutation	Average:8.997; most accessible tissue: Callus, score: 19.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408367382	NA	3.63E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382	9.77E-07	NA	mr1065	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382	4.67E-06	NA	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382	2.15E-06	NA	mr1091	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382	4.53E-06	NA	mr1094	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382	2.03E-06	NA	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382	4.05E-06	NA	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382	9.24E-06	NA	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408367382	NA	3.51E-21	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251