\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408318442:

Variant ID: vg0408318442 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8318442
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGACTTGAGAATCAGGTTATCAGTTTGAGGGTTTTTTTTATTCCGATAAATTTTCGTTACCATATTCACGCCGGTTCATTTTCGCTCCGTTTTCGGTTT[T/C]
GATAATATTTGATTCCATTTTCATATCCGGCCGGGGTTTTCGATTCCGATTTTGATTCGAAAAAAAATATAAAAATAAAAATGATAAAGATGATTTCCGT

Reverse complement sequence

ACGGAAATCATCTTTATCATTTTTATTTTTATATTTTTTTTCGAATCAAAATCGGAATCGAAAACCCCGGCCGGATATGAAAATGGAATCAAATATTATC[A/G]
AAACCGAAAACGGAGCGAAAATGAACCGGCGTGAATATGGTAACGAAAATTTATCGGAATAAAAAAAACCCTCAAACTGATAACCTGATTCTCAAGTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 21.50% 8.00% 31.99% NA
All Indica  2759 32.60% 2.30% 12.14% 52.95% NA
All Japonica  1512 37.40% 61.60% 0.66% 0.33% NA
Aus  269 82.50% 0.00% 7.81% 9.67% NA
Indica I  595 19.80% 1.20% 12.10% 66.89% NA
Indica II  465 24.70% 2.40% 12.04% 60.86% NA
Indica III  913 44.00% 3.00% 13.03% 39.98% NA
Indica Intermediate  786 33.70% 2.30% 11.20% 52.80% NA
Temperate Japonica  767 3.90% 95.80% 0.00% 0.26% NA
Tropical Japonica  504 92.30% 6.30% 1.39% 0.00% NA
Japonica Intermediate  241 29.00% 68.50% 1.24% 1.24% NA
VI/Aromatic  96 95.80% 2.10% 1.04% 1.04% NA
Intermediate  90 47.80% 18.90% 12.22% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408318442 T -> C LOC_Os04g14790.1 upstream_gene_variant ; 4187.0bp to feature; MODIFIER silent_mutation Average:40.936; most accessible tissue: Callus, score: 75.848 N N N N
vg0408318442 T -> C LOC_Os04g14810.1 downstream_gene_variant ; 2121.0bp to feature; MODIFIER silent_mutation Average:40.936; most accessible tissue: Callus, score: 75.848 N N N N
vg0408318442 T -> C LOC_Os04g14820.1 downstream_gene_variant ; 4216.0bp to feature; MODIFIER silent_mutation Average:40.936; most accessible tissue: Callus, score: 75.848 N N N N
vg0408318442 T -> C LOC_Os04g14790-LOC_Os04g14810 intergenic_region ; MODIFIER silent_mutation Average:40.936; most accessible tissue: Callus, score: 75.848 N N N N
vg0408318442 T -> DEL N N silent_mutation Average:40.936; most accessible tissue: Callus, score: 75.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408318442 NA 9.95E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 3.25E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 2.09E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 7.89E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 8.12E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 8.40E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 1.07E-10 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 1.32E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 4.27E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 7.69E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 6.79E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 6.69E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 2.57E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 4.95E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 8.84E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 1.07E-24 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 2.60E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 3.24E-17 mr1982 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 1.13E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408318442 NA 5.60E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251