\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408114436:

Variant ID: vg0408114436 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8114436
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GTACATAGTGAAAGTAGATATTTTATTTGAAAATTATGCATTGCAAGCATAGCTAGTCTTCATTAATTGGATAATATTGACGGTCGAAATTGGTCGATAA[T/C]
GATGTCAACAGGCGCGCAATCAATAGGGAGCGAGCATGGTGCCCAACTTATAGAGAGTGACTTTCATGGGAAAGGAACTCTAATTCTCAAGTAGATGTTT

Reverse complement sequence

AAACATCTACTTGAGAATTAGAGTTCCTTTCCCATGAAAGTCACTCTCTATAAGTTGGGCACCATGCTCGCTCCCTATTGATTGCGCGCCTGTTGACATC[A/G]
TTATCGACCAATTTCGACCGTCAATATTATCCAATTAATGAAGACTAGCTATGCTTGCAATGCATAATTTTCAAATAAAATATCTACTTTCACTATGTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.00% 25.40% 14.20% 32.37% NA
All Indica  2759 19.10% 7.90% 18.99% 54.08% NA
All Japonica  1512 36.80% 62.30% 0.53% 0.40% NA
Aus  269 43.10% 5.20% 45.35% 6.32% NA
Indica I  595 16.80% 2.50% 17.82% 62.86% NA
Indica II  465 16.10% 24.70% 13.55% 45.59% NA
Indica III  913 18.70% 4.70% 22.23% 54.33% NA
Indica Intermediate  786 22.90% 5.60% 19.34% 52.16% NA
Temperate Japonica  767 3.80% 96.10% 0.13% 0.00% NA
Tropical Japonica  504 90.90% 6.90% 1.19% 0.99% NA
Japonica Intermediate  241 28.60% 70.50% 0.41% 0.41% NA
VI/Aromatic  96 85.40% 1.00% 12.50% 1.04% NA
Intermediate  90 47.80% 31.10% 5.56% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408114436 T -> C LOC_Os04g14500.1 upstream_gene_variant ; 1941.0bp to feature; MODIFIER silent_mutation Average:44.67; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0408114436 T -> C LOC_Os04g14510.1 downstream_gene_variant ; 2998.0bp to feature; MODIFIER silent_mutation Average:44.67; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0408114436 T -> C LOC_Os04g14510.2 downstream_gene_variant ; 2998.0bp to feature; MODIFIER silent_mutation Average:44.67; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0408114436 T -> C LOC_Os04g14500-LOC_Os04g14510 intergenic_region ; MODIFIER silent_mutation Average:44.67; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0408114436 T -> DEL N N silent_mutation Average:44.67; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0408114436 T C -0.08 -0.02 -0.02 -0.04 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408114436 NA 5.64E-08 mr1047 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 2.63E-19 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 3.53E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 2.27E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 2.42E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 8.56E-12 mr1454 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 1.49E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 5.70E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 1.50E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 1.71E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 8.90E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 9.31E-06 mr1892 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 5.79E-06 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 2.20E-20 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436 NA 4.56E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251