Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0408114436:

Variant ID: vg0408114436 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8114436
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

GTACATAGTGAAAGTAGATATTTTATTTGAAAATTATGCATTGCAAGCATAGCTAGTCTTCATTAATTGGATAATATTGACGGTCGAAATTGGTCGATAA[T/C]
GATGTCAACAGGCGCGCAATCAATAGGGAGCGAGCATGGTGCCCAACTTATAGAGAGTGACTTTCATGGGAAAGGAACTCTAATTCTCAAGTAGATGTTT

Reverse complement sequence

AAACATCTACTTGAGAATTAGAGTTCCTTTCCCATGAAAGTCACTCTCTATAAGTTGGGCACCATGCTCGCTCCCTATTGATTGCGCGCCTGTTGACATC[A/G]
TTATCGACCAATTTCGACCGTCAATATTATCCAATTAATGAAGACTAGCTATGCTTGCAATGCATAATTTTCAAATAAAATATCTACTTTCACTATGTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.00%	25.40%	14.20%	32.37%	NA
All Indica	2759	19.10%	7.90%	18.99%	54.08%	NA
All Japonica	1512	36.80%	62.30%	0.53%	0.40%	NA
Aus	269	43.10%	5.20%	45.35%	6.32%	NA
Indica I	595	16.80%	2.50%	17.82%	62.86%	NA
Indica II	465	16.10%	24.70%	13.55%	45.59%	NA
Indica III	913	18.70%	4.70%	22.23%	54.33%	NA
Indica Intermediate	786	22.90%	5.60%	19.34%	52.16%	NA
Temperate Japonica	767	3.80%	96.10%	0.13%	0.00%	NA
Tropical Japonica	504	90.90%	6.90%	1.19%	0.99%	NA
Japonica Intermediate	241	28.60%	70.50%	0.41%	0.41%	NA
VI/Aromatic	96	85.40%	1.00%	12.50%	1.04%	NA
Intermediate	90	47.80%	31.10%	5.56%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408114436	T -> C	LOC_Os04g14500.1	upstream_gene_variant ; 1941.0bp to feature; MODIFIER	silent_mutation	Average:44.67; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg0408114436	T -> C	LOC_Os04g14510.1	downstream_gene_variant ; 2998.0bp to feature; MODIFIER	silent_mutation	Average:44.67; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg0408114436	T -> C	LOC_Os04g14510.2	downstream_gene_variant ; 2998.0bp to feature; MODIFIER	silent_mutation	Average:44.67; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg0408114436	T -> C	LOC_Os04g14500-LOC_Os04g14510	intergenic_region ; MODIFIER	silent_mutation	Average:44.67; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg0408114436	T -> DEL	N	N	silent_mutation	Average:44.67; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0408114436	T	C	-0.08	-0.02	-0.02	-0.04	-0.05	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408114436	NA	5.64E-08	mr1047	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	2.63E-19	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	3.53E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	2.27E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	2.42E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	8.56E-12	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	1.49E-11	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	5.70E-08	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	1.50E-06	mr1625	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	1.71E-07	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	8.90E-07	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	9.31E-06	mr1892	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	5.79E-06	mr1990	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	2.20E-20	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408114436	NA	4.56E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251