\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408107056:

Variant ID: vg0408107056 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 8107056
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATGAGAGAAGAATCATCGGTCATTAGAGATAAGTCTCCTTCACATGATGCTATGGATGTTAGTACGGTATTCATCTTGCCTTCGAAATCGTGCAATC[A/T]
AGAAAGCCGATTTTGCTTGGGGGGCAAGACATTAATATGCTCATAAGGGAACCAAGAGAAGATGAACGGCGATGGATACAATACCACATCTTTGAGCCGC

Reverse complement sequence

GCGGCTCAAAGATGTGGTATTGTATCCATCGCCGTTCATCTTCTCTTGGTTCCCTTATGAGCATATTAATGTCTTGCCCCCCAAGCAAAATCGGCTTTCT[T/A]
GATTGCACGATTTCGAAGGCAAGATGAATACCGTACTAACATCCATAGCATCATGTGAAGGAGACTTATCTCTAATGACCGATGATTCTTCTCTCATCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 0.10% 6.26% 26.41% NA
All Indica  2759 53.30% 0.20% 7.47% 39.04% NA
All Japonica  1512 90.20% 0.00% 4.70% 5.09% NA
Aus  269 72.90% 0.00% 4.09% 23.05% NA
Indica I  595 46.70% 0.20% 7.39% 45.71% NA
Indica II  465 65.60% 0.00% 5.59% 28.82% NA
Indica III  913 51.90% 0.30% 7.89% 39.87% NA
Indica Intermediate  786 52.50% 0.30% 8.14% 39.06% NA
Temperate Japonica  767 97.30% 0.00% 1.43% 1.30% NA
Tropical Japonica  504 80.40% 0.00% 9.72% 9.92% NA
Japonica Intermediate  241 88.40% 0.00% 4.56% 7.05% NA
VI/Aromatic  96 79.20% 0.00% 4.17% 16.67% NA
Intermediate  90 77.80% 0.00% 4.44% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0408107056 A -> DEL N N silent_mutation Average:7.189; most accessible tissue: Callus, score: 15.05 N N N N
vg0408107056 A -> T LOC_Os04g14480.1 upstream_gene_variant ; 4952.0bp to feature; MODIFIER silent_mutation Average:7.189; most accessible tissue: Callus, score: 15.05 N N N N
vg0408107056 A -> T LOC_Os04g14490.1 downstream_gene_variant ; 988.0bp to feature; MODIFIER silent_mutation Average:7.189; most accessible tissue: Callus, score: 15.05 N N N N
vg0408107056 A -> T LOC_Os04g14500.1 downstream_gene_variant ; 3183.0bp to feature; MODIFIER silent_mutation Average:7.189; most accessible tissue: Callus, score: 15.05 N N N N
vg0408107056 A -> T LOC_Os04g14490-LOC_Os04g14500 intergenic_region ; MODIFIER silent_mutation Average:7.189; most accessible tissue: Callus, score: 15.05 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0408107056 NA 8.27E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408107056 2.56E-07 5.63E-09 mr1498_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408107056 NA 1.32E-09 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408107056 3.43E-08 3.21E-12 mr1800_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408107056 3.96E-06 3.96E-06 mr1925_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251