Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0408107056:

Variant ID: vg0408107056 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8107056
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

TTGATGAGAGAAGAATCATCGGTCATTAGAGATAAGTCTCCTTCACATGATGCTATGGATGTTAGTACGGTATTCATCTTGCCTTCGAAATCGTGCAATC[A/T]
AGAAAGCCGATTTTGCTTGGGGGGCAAGACATTAATATGCTCATAAGGGAACCAAGAGAAGATGAACGGCGATGGATACAATACCACATCTTTGAGCCGC

Reverse complement sequence

GCGGCTCAAAGATGTGGTATTGTATCCATCGCCGTTCATCTTCTCTTGGTTCCCTTATGAGCATATTAATGTCTTGCCCCCCAAGCAAAATCGGCTTTCT[T/A]
GATTGCACGATTTCGAAGGCAAGATGAATACCGTACTAACATCCATAGCATCATGTGAAGGAGACTTATCTCTAATGACCGATGATTCTTCTCTCATCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	0.10%	6.26%	26.41%	NA
All Indica	2759	53.30%	0.20%	7.47%	39.04%	NA
All Japonica	1512	90.20%	0.00%	4.70%	5.09%	NA
Aus	269	72.90%	0.00%	4.09%	23.05%	NA
Indica I	595	46.70%	0.20%	7.39%	45.71%	NA
Indica II	465	65.60%	0.00%	5.59%	28.82%	NA
Indica III	913	51.90%	0.30%	7.89%	39.87%	NA
Indica Intermediate	786	52.50%	0.30%	8.14%	39.06%	NA
Temperate Japonica	767	97.30%	0.00%	1.43%	1.30%	NA
Tropical Japonica	504	80.40%	0.00%	9.72%	9.92%	NA
Japonica Intermediate	241	88.40%	0.00%	4.56%	7.05%	NA
VI/Aromatic	96	79.20%	0.00%	4.17%	16.67%	NA
Intermediate	90	77.80%	0.00%	4.44%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408107056	A -> DEL	N	N	silent_mutation	Average:7.189; most accessible tissue: Callus, score: 15.05	N	N	N	N
vg0408107056	A -> T	LOC_Os04g14480.1	upstream_gene_variant ; 4952.0bp to feature; MODIFIER	silent_mutation	Average:7.189; most accessible tissue: Callus, score: 15.05	N	N	N	N
vg0408107056	A -> T	LOC_Os04g14490.1	downstream_gene_variant ; 988.0bp to feature; MODIFIER	silent_mutation	Average:7.189; most accessible tissue: Callus, score: 15.05	N	N	N	N
vg0408107056	A -> T	LOC_Os04g14500.1	downstream_gene_variant ; 3183.0bp to feature; MODIFIER	silent_mutation	Average:7.189; most accessible tissue: Callus, score: 15.05	N	N	N	N
vg0408107056	A -> T	LOC_Os04g14490-LOC_Os04g14500	intergenic_region ; MODIFIER	silent_mutation	Average:7.189; most accessible tissue: Callus, score: 15.05	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408107056	NA	8.27E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408107056	2.56E-07	5.63E-09	mr1498_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408107056	NA	1.32E-09	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408107056	3.43E-08	3.21E-12	mr1800_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408107056	3.96E-06	3.96E-06	mr1925_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251